Incidental Mutation 'R7255:Tlr5'
ID 564177
Institutional Source Beutler Lab
Gene Symbol Tlr5
Ensembl Gene ENSMUSG00000079164
Gene Name toll-like receptor 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock # R7255 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 182954788-182976044 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 182974316 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 395 (F395S)
Ref Sequence ENSEMBL: ENSMUSP00000106625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110997] [ENSMUST00000191820] [ENSMUST00000193687]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000110997
AA Change: F395S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106625
Gene: ENSMUSG00000079164
AA Change: F395S

DomainStartEndE-ValueType
low complexity region 83 92 N/A INTRINSIC
LRR_TYP 109 132 3.11e-2 SMART
LRR 159 183 5.56e0 SMART
LRR 184 207 1.97e2 SMART
low complexity region 262 275 N/A INTRINSIC
LRR 326 349 7.05e-1 SMART
LRR 350 373 2.92e1 SMART
LRR 374 397 2.54e1 SMART
LRR 398 418 1.29e2 SMART
low complexity region 441 456 N/A INTRINSIC
LRR_TYP 516 539 1.06e-4 SMART
LRR 540 563 6.13e-1 SMART
LRR 564 585 2.21e2 SMART
LRRCT 594 645 7.01e-6 SMART
low complexity region 657 676 N/A INTRINSIC
TIR 707 852 3.89e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191820
AA Change: F381S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141458
Gene: ENSMUSG00000079164
AA Change: F381S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
LRR_TYP 95 118 1.3e-4 SMART
LRR 145 169 2.3e-2 SMART
LRR 170 193 8.2e-1 SMART
low complexity region 248 261 N/A INTRINSIC
LRR 312 335 2.9e-3 SMART
LRR 336 359 1.2e-1 SMART
LRR 360 383 1.1e-1 SMART
LRR 384 404 5.4e-1 SMART
low complexity region 427 442 N/A INTRINSIC
LRR_TYP 502 525 4.5e-7 SMART
LRR 526 549 2.5e-3 SMART
LRR 550 571 9.4e-1 SMART
LRRCT 580 631 3.4e-8 SMART
transmembrane domain 642 664 N/A INTRINSIC
TIR 693 838 2.5e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193687
AA Change: F395S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141318
Gene: ENSMUSG00000079164
AA Change: F395S

DomainStartEndE-ValueType
low complexity region 83 92 N/A INTRINSIC
LRR_TYP 109 132 1.3e-4 SMART
LRR 159 183 2.3e-2 SMART
LRR 184 207 8.2e-1 SMART
low complexity region 262 275 N/A INTRINSIC
LRR 326 349 2.9e-3 SMART
LRR 350 373 1.2e-1 SMART
LRR 374 397 1.1e-1 SMART
LRR 398 418 5.4e-1 SMART
low complexity region 441 456 N/A INTRINSIC
LRR_TYP 516 539 4.5e-7 SMART
LRR 540 563 2.5e-3 SMART
LRR 564 585 9.4e-1 SMART
LRRCT 594 645 3.4e-8 SMART
transmembrane domain 656 678 N/A INTRINSIC
TIR 707 852 2.5e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immune responses. These receptors recognize distinct pathogen-associated molecular patterns that are expressed on infectious agents. The protein encoded by this gene recognizes bacterial flagellin, the principal component of bacterial flagella and a virulence factor. The activation of this receptor mobilizes the nuclear factor NF-kappaB, which in turn activates a host of inflammatory-related target genes. Mutations in this gene have been associated with both resistance and susceptibility to systemic lupus erythematosus, and susceptibility to Legionnaire disease.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for disruption of this gene have a generally normal phenotype. However they fail to respond immunologically to purified flagellin and are resistant to infection with Salmonella typhimurium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G A 11: 23,620,465 P145L probably benign Het
9530003J23Rik T C 10: 117,234,422 H150R probably benign Het
Aldh1a7 A G 19: 20,714,728 S234P probably damaging Het
Arhgap28 T C 17: 67,853,004 H650R probably damaging Het
Asic1 A G 15: 99,697,457 D355G probably damaging Het
Atp8b1 T A 18: 64,556,868 S598C probably damaging Het
Bcat1 C A 6: 145,032,785 E237* probably null Het
Btbd16 A T 7: 130,785,992 I114F probably benign Het
Casp2 A G 6: 42,268,907 D166G probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cpsf1 G A 15: 76,597,543 T1099M probably damaging Het
Crisp4 C A 1: 18,130,231 A116S probably damaging Het
Cyb5r3 A G 15: 83,160,165 I168T probably damaging Het
Dip2b G A 15: 100,209,627 D1407N probably benign Het
Dnajc8 A G 4: 132,551,573 K201R probably benign Het
Dock10 C T 1: 80,543,099 probably null Het
Dopey2 C A 16: 93,770,146 H1272N probably damaging Het
Dsc1 C T 18: 20,097,273 R325Q probably benign Het
Enpp1 A T 10: 24,645,315 I838K possibly damaging Het
Fcna T G 2: 25,626,028 D159A probably damaging Het
Flnc G T 6: 29,445,766 G840C probably damaging Het
Flt1 C T 5: 147,580,406 A1024T probably damaging Het
Galc T C 12: 98,246,255 K207R probably null Het
Gbp2b T A 3: 142,608,117 L386Q probably damaging Het
Gm8297 T A 14: 4,984,874 N48K probably damaging Het
Gm9639 G A 10: 77,794,538 P180L unknown Het
Inpp5a A G 7: 139,511,448 N116S probably damaging Het
Ipo9 T C 1: 135,385,988 E984G probably benign Het
Klra4 A G 6: 130,059,642 F145L probably damaging Het
Lag3 A G 6: 124,910,235 L123P probably benign Het
Med7 T A 11: 46,440,995 M139K probably damaging Het
Mfsd2a A C 4: 122,952,021 L153R possibly damaging Het
Mup9 A G 4: 60,421,337 V71A probably benign Het
Myo16 A T 8: 10,499,169 Q927L unknown Het
Myo9b T C 8: 71,290,891 Y199H probably damaging Het
Nefm A G 14: 68,116,000 F406L probably benign Het
Olfr1123 T A 2: 87,418,942 L296Q probably damaging Het
Olfr1333 A T 4: 118,829,952 F162I probably benign Het
Pamr1 T C 2: 102,611,584 F173L probably damaging Het
Pds5b T A 5: 150,796,667 D1205E probably benign Het
Plxna2 T G 1: 194,752,103 F646V probably benign Het
Pnrc1 C T 4: 33,248,045 G118D probably benign Het
Ppp1r16b T C 2: 158,761,391 F412S probably benign Het
Prcc A T 3: 87,870,091 V192E probably damaging Het
Psg19 A G 7: 18,794,048 Y257H probably benign Het
Rfx7 T G 9: 72,619,828 S1433R possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Sbspon G T 1: 15,883,797 C86* probably null Het
Sdhb A G 4: 140,977,418 E230G possibly damaging Het
Sema6b T C 17: 56,125,336 T581A probably benign Het
Shkbp1 G T 7: 27,342,748 T594K possibly damaging Het
Shpk A G 11: 73,199,660 S48G probably benign Het
Slc1a3 A G 15: 8,642,999 V332A possibly damaging Het
Slc25a25 T C 2: 32,421,372 E135G possibly damaging Het
Slc5a8 A T 10: 88,909,631 D367V probably damaging Het
Slco1c1 A G 6: 141,569,325 T649A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats1 T A 17: 45,454,205 D163V probably damaging Het
Ssh2 T A 11: 77,425,593 M304K probably damaging Het
Sulf1 T A 1: 12,859,008 D166E probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Tcf7l1 A T 6: 72,627,347 probably null Het
Tet1 A T 10: 62,822,636 M1477K probably benign Het
Trrap T C 5: 144,858,954 L3847P probably damaging Het
Tsks C T 7: 44,952,688 S276L probably benign Het
Uggt1 T C 1: 36,146,106 E1519G probably damaging Het
Vps13a A G 19: 16,654,339 probably null Het
Wdfy4 A G 14: 32,974,282 V2768A Het
Wdr26 A C 1: 181,181,324 I627R probably benign Het
Zfp160 T A 17: 21,025,487 S100T probably benign Het
Other mutations in Tlr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Tlr5 APN 1 182973829 missense probably benign
IGL00940:Tlr5 APN 1 182974196 missense possibly damaging 0.84
IGL01302:Tlr5 APN 1 182974748 missense probably benign 0.00
IGL01480:Tlr5 APN 1 182973499 missense probably benign 0.09
IGL01717:Tlr5 APN 1 182975398 missense probably damaging 1.00
IGL01896:Tlr5 APN 1 182974879 missense possibly damaging 0.64
IGL02083:Tlr5 APN 1 182973884 missense possibly damaging 0.91
IGL02135:Tlr5 APN 1 182973254 missense possibly damaging 0.82
R0464:Tlr5 UTSW 1 182973710 missense probably benign 0.01
R0552:Tlr5 UTSW 1 182975696 splice site probably null
R0556:Tlr5 UTSW 1 182974151 missense probably damaging 1.00
R0639:Tlr5 UTSW 1 182973889 missense probably damaging 1.00
R0670:Tlr5 UTSW 1 182973889 missense probably damaging 1.00
R1014:Tlr5 UTSW 1 182975677 missense probably benign 0.00
R1125:Tlr5 UTSW 1 182973892 missense probably benign 0.00
R1563:Tlr5 UTSW 1 182975010 missense probably benign 0.09
R1775:Tlr5 UTSW 1 182973722 missense probably damaging 0.99
R1793:Tlr5 UTSW 1 182972447 missense probably benign 0.00
R1991:Tlr5 UTSW 1 182974347 missense probably damaging 1.00
R1992:Tlr5 UTSW 1 182974347 missense probably damaging 1.00
R2114:Tlr5 UTSW 1 182975629 missense probably damaging 1.00
R2116:Tlr5 UTSW 1 182975629 missense probably damaging 1.00
R2225:Tlr5 UTSW 1 182972376 start gained probably benign
R2265:Tlr5 UTSW 1 182975035 missense possibly damaging 0.63
R2266:Tlr5 UTSW 1 182975035 missense possibly damaging 0.63
R2268:Tlr5 UTSW 1 182975035 missense possibly damaging 0.63
R2882:Tlr5 UTSW 1 182973893 missense probably damaging 1.00
R3695:Tlr5 UTSW 1 182975347 missense probably damaging 1.00
R3747:Tlr5 UTSW 1 182974439 missense probably benign 0.01
R3749:Tlr5 UTSW 1 182974439 missense probably benign 0.01
R4084:Tlr5 UTSW 1 182974848 missense possibly damaging 0.60
R4794:Tlr5 UTSW 1 182973896 missense probably benign 0.00
R4895:Tlr5 UTSW 1 182974199 missense probably damaging 1.00
R4964:Tlr5 UTSW 1 182973473 missense probably benign 0.07
R4966:Tlr5 UTSW 1 182973473 missense probably benign 0.07
R5496:Tlr5 UTSW 1 182973632 missense probably damaging 1.00
R6056:Tlr5 UTSW 1 182974038 missense possibly damaging 0.76
R6715:Tlr5 UTSW 1 182972659 intron probably benign
R6825:Tlr5 UTSW 1 182973044 intron probably benign
R6961:Tlr5 UTSW 1 182973511 nonsense probably null
R7135:Tlr5 UTSW 1 182975523 missense possibly damaging 0.87
R7232:Tlr5 UTSW 1 182973499 missense probably benign 0.09
R7257:Tlr5 UTSW 1 182974233 nonsense probably null
R8887:Tlr5 UTSW 1 182973767 missense probably benign 0.07
R9116:Tlr5 UTSW 1 182974595 missense probably benign
R9224:Tlr5 UTSW 1 182975128 missense probably benign 0.10
R9284:Tlr5 UTSW 1 182973812 missense probably benign 0.00
Z1177:Tlr5 UTSW 1 182973817 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTGTTTGGGACACTGAAGG -3'
(R):5'- TCGGACAGGTTTTCTAGCCTG -3'

Sequencing Primer
(F):5'- TGAAGATGCTGAACCTTGCC -3'
(R):5'- GTTTTCAGATAACTCTAGGAAGTTGG -3'
Posted On 2019-06-26