Mutagenetix > Incidental Mutations

Incidental Mutation 'R7255:Tlr5'

564177

Institutional Source

Beutler Lab

Gene Symbol

Tlr5

Ensembl Gene

ENSMUSG00000079164

Gene Name

toll-like receptor 5

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.290) question?

Stock #

R7255 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

182954788-182976044 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 182974316 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 395 (F395S)

Ref Sequence

ENSEMBL: ENSMUSP00000106625 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110997] [ENSMUST00000191820] [ENSMUST00000193687]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000110997
AA Change: F395S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106625
Gene: ENSMUSG00000079164
AA Change: F395S

Domain	Start	End	E-Value	Type
low complexity region	83	92	N/A	INTRINSIC
LRR_TYP	109	132	3.11e-2	SMART
LRR	159	183	5.56e0	SMART
LRR	184	207	1.97e2	SMART
low complexity region	262	275	N/A	INTRINSIC
LRR	326	349	7.05e-1	SMART
LRR	350	373	2.92e1	SMART
LRR	374	397	2.54e1	SMART
LRR	398	418	1.29e2	SMART
low complexity region	441	456	N/A	INTRINSIC
LRR_TYP	516	539	1.06e-4	SMART
LRR	540	563	6.13e-1	SMART
LRR	564	585	2.21e2	SMART
LRRCT	594	645	7.01e-6	SMART
low complexity region	657	676	N/A	INTRINSIC
TIR	707	852	3.89e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000191820
AA Change: F381S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141458
Gene: ENSMUSG00000079164
AA Change: F381S

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	69	78	N/A	INTRINSIC
LRR_TYP	95	118	1.3e-4	SMART
LRR	145	169	2.3e-2	SMART
LRR	170	193	8.2e-1	SMART
low complexity region	248	261	N/A	INTRINSIC
LRR	312	335	2.9e-3	SMART
LRR	336	359	1.2e-1	SMART
LRR	360	383	1.1e-1	SMART
LRR	384	404	5.4e-1	SMART
low complexity region	427	442	N/A	INTRINSIC
LRR_TYP	502	525	4.5e-7	SMART
LRR	526	549	2.5e-3	SMART
LRR	550	571	9.4e-1	SMART
LRRCT	580	631	3.4e-8	SMART
transmembrane domain	642	664	N/A	INTRINSIC
TIR	693	838	2.5e-27	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000193687
AA Change: F395S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141318
Gene: ENSMUSG00000079164
AA Change: F395S

Domain	Start	End	E-Value	Type
low complexity region	83	92	N/A	INTRINSIC
LRR_TYP	109	132	1.3e-4	SMART
LRR	159	183	2.3e-2	SMART
LRR	184	207	8.2e-1	SMART
low complexity region	262	275	N/A	INTRINSIC
LRR	326	349	2.9e-3	SMART
LRR	350	373	1.2e-1	SMART
LRR	374	397	1.1e-1	SMART
LRR	398	418	5.4e-1	SMART
low complexity region	441	456	N/A	INTRINSIC
LRR_TYP	516	539	4.5e-7	SMART
LRR	540	563	2.5e-3	SMART
LRR	564	585	9.4e-1	SMART
LRRCT	594	645	3.4e-8	SMART
transmembrane domain	656	678	N/A	INTRINSIC
TIR	707	852	2.5e-27	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immune responses. These receptors recognize distinct pathogen-associated molecular patterns that are expressed on infectious agents. The protein encoded by this gene recognizes bacterial flagellin, the principal component of bacterial flagella and a virulence factor. The activation of this receptor mobilizes the nuclear factor NF-kappaB, which in turn activates a host of inflammatory-related target genes. Mutations in this gene have been associated with both resistance and susceptibility to systemic lupus erythematosus, and susceptibility to Legionnaire disease.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for disruption of this gene have a generally normal phenotype. However they fail to respond immunologically to purified flagellin and are resistant to infection with Salmonella typhimurium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	G	A	11: 23,620,465	P145L	probably benign	Het
9530003J23Rik	T	C	10: 117,234,422	H150R	probably benign	Het
Aldh1a7	A	G	19: 20,714,728	S234P	probably damaging	Het
Arhgap28	T	C	17: 67,853,004	H650R	probably damaging	Het
Asic1	A	G	15: 99,697,457	D355G	probably damaging	Het
Atp8b1	T	A	18: 64,556,868	S598C	probably damaging	Het
Bcat1	C	A	6: 145,032,785	E237*	probably null	Het
Btbd16	A	T	7: 130,785,992	I114F	probably benign	Het
Casp2	A	G	6: 42,268,907	D166G	probably damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cpsf1	G	A	15: 76,597,543	T1099M	probably damaging	Het
Crisp4	C	A	1: 18,130,231	A116S	probably damaging	Het
Cyb5r3	A	G	15: 83,160,165	I168T	probably damaging	Het
Dip2b	G	A	15: 100,209,627	D1407N	probably benign	Het
Dnajc8	A	G	4: 132,551,573	K201R	probably benign	Het
Dock10	C	T	1: 80,543,099		probably null	Het
Dopey2	C	A	16: 93,770,146	H1272N	probably damaging	Het
Dsc1	C	T	18: 20,097,273	R325Q	probably benign	Het
Enpp1	A	T	10: 24,645,315	I838K	possibly damaging	Het
Fcna	T	G	2: 25,626,028	D159A	probably damaging	Het
Flnc	G	T	6: 29,445,766	G840C	probably damaging	Het
Flt1	C	T	5: 147,580,406	A1024T	probably damaging	Het
Galc	T	C	12: 98,246,255	K207R	probably null	Het
Gbp2b	T	A	3: 142,608,117	L386Q	probably damaging	Het
Gm8297	T	A	14: 4,984,874	N48K	probably damaging	Het
Gm9639	G	A	10: 77,794,538	P180L	unknown	Het
Inpp5a	A	G	7: 139,511,448	N116S	probably damaging	Het
Ipo9	T	C	1: 135,385,988	E984G	probably benign	Het
Klra4	A	G	6: 130,059,642	F145L	probably damaging	Het
Lag3	A	G	6: 124,910,235	L123P	probably benign	Het
Med7	T	A	11: 46,440,995	M139K	probably damaging	Het
Mfsd2a	A	C	4: 122,952,021	L153R	possibly damaging	Het
Mup9	A	G	4: 60,421,337	V71A	probably benign	Het
Myo16	A	T	8: 10,499,169	Q927L	unknown	Het
Myo9b	T	C	8: 71,290,891	Y199H	probably damaging	Het
Nefm	A	G	14: 68,116,000	F406L	probably benign	Het
Olfr1123	T	A	2: 87,418,942	L296Q	probably damaging	Het
Olfr1333	A	T	4: 118,829,952	F162I	probably benign	Het
Pamr1	T	C	2: 102,611,584	F173L	probably damaging	Het
Pds5b	T	A	5: 150,796,667	D1205E	probably benign	Het
Plxna2	T	G	1: 194,752,103	F646V	probably benign	Het
Pnrc1	C	T	4: 33,248,045	G118D	probably benign	Het
Ppp1r16b	T	C	2: 158,761,391	F412S	probably benign	Het
Prcc	A	T	3: 87,870,091	V192E	probably damaging	Het
Psg19	A	G	7: 18,794,048	Y257H	probably benign	Het
Rfx7	T	G	9: 72,619,828	S1433R	possibly damaging	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Sbspon	G	T	1: 15,883,797	C86*	probably null	Het
Sdhb	A	G	4: 140,977,418	E230G	possibly damaging	Het
Sema6b	T	C	17: 56,125,336	T581A	probably benign	Het
Shkbp1	G	T	7: 27,342,748	T594K	possibly damaging	Het
Shpk	A	G	11: 73,199,660	S48G	probably benign	Het
Slc1a3	A	G	15: 8,642,999	V332A	possibly damaging	Het
Slc25a25	T	C	2: 32,421,372	E135G	possibly damaging	Het
Slc5a8	A	T	10: 88,909,631	D367V	probably damaging	Het
Slco1c1	A	G	6: 141,569,325	T649A	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spats1	T	A	17: 45,454,205	D163V	probably damaging	Het
Ssh2	T	A	11: 77,425,593	M304K	probably damaging	Het
Sulf1	T	A	1: 12,859,008	D166E	probably benign	Het
Syne1	A	G	10: 5,333,446	S1540P	probably damaging	Het
Tcf7l1	A	T	6: 72,627,347		probably null	Het
Tet1	A	T	10: 62,822,636	M1477K	probably benign	Het
Trrap	T	C	5: 144,858,954	L3847P	probably damaging	Het
Tsks	C	T	7: 44,952,688	S276L	probably benign	Het
Uggt1	T	C	1: 36,146,106	E1519G	probably damaging	Het
Vps13a	A	G	19: 16,654,339		probably null	Het
Wdfy4	A	G	14: 32,974,282	V2768A		Het
Wdr26	A	C	1: 181,181,324	I627R	probably benign	Het
Zfp160	T	A	17: 21,025,487	S100T	probably benign	Het

Other mutations in Tlr5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Tlr5	APN	1	182973829	missense	probably benign
IGL00940:Tlr5	APN	1	182974196	missense	possibly damaging	0.84
IGL01302:Tlr5	APN	1	182974748	missense	probably benign	0.00
IGL01480:Tlr5	APN	1	182973499	missense	probably benign	0.09
IGL01717:Tlr5	APN	1	182975398	missense	probably damaging	1.00
IGL01896:Tlr5	APN	1	182974879	missense	possibly damaging	0.64
IGL02083:Tlr5	APN	1	182973884	missense	possibly damaging	0.91
IGL02135:Tlr5	APN	1	182973254	missense	possibly damaging	0.82
R0464:Tlr5	UTSW	1	182973710	missense	probably benign	0.01
R0552:Tlr5	UTSW	1	182975696	splice site	probably null
R0556:Tlr5	UTSW	1	182974151	missense	probably damaging	1.00
R0639:Tlr5	UTSW	1	182973889	missense	probably damaging	1.00
R0670:Tlr5	UTSW	1	182973889	missense	probably damaging	1.00
R1014:Tlr5	UTSW	1	182975677	missense	probably benign	0.00
R1125:Tlr5	UTSW	1	182973892	missense	probably benign	0.00
R1563:Tlr5	UTSW	1	182975010	missense	probably benign	0.09
R1775:Tlr5	UTSW	1	182973722	missense	probably damaging	0.99
R1793:Tlr5	UTSW	1	182972447	missense	probably benign	0.00
R1991:Tlr5	UTSW	1	182974347	missense	probably damaging	1.00
R1992:Tlr5	UTSW	1	182974347	missense	probably damaging	1.00
R2114:Tlr5	UTSW	1	182975629	missense	probably damaging	1.00
R2116:Tlr5	UTSW	1	182975629	missense	probably damaging	1.00
R2225:Tlr5	UTSW	1	182972376	start gained	probably benign
R2265:Tlr5	UTSW	1	182975035	missense	possibly damaging	0.63
R2266:Tlr5	UTSW	1	182975035	missense	possibly damaging	0.63
R2268:Tlr5	UTSW	1	182975035	missense	possibly damaging	0.63
R2882:Tlr5	UTSW	1	182973893	missense	probably damaging	1.00
R3695:Tlr5	UTSW	1	182975347	missense	probably damaging	1.00
R3747:Tlr5	UTSW	1	182974439	missense	probably benign	0.01
R3749:Tlr5	UTSW	1	182974439	missense	probably benign	0.01
R4084:Tlr5	UTSW	1	182974848	missense	possibly damaging	0.60
R4794:Tlr5	UTSW	1	182973896	missense	probably benign	0.00
R4895:Tlr5	UTSW	1	182974199	missense	probably damaging	1.00
R4964:Tlr5	UTSW	1	182973473	missense	probably benign	0.07
R4966:Tlr5	UTSW	1	182973473	missense	probably benign	0.07
R5496:Tlr5	UTSW	1	182973632	missense	probably damaging	1.00
R6056:Tlr5	UTSW	1	182974038	missense	possibly damaging	0.76
R6715:Tlr5	UTSW	1	182972659	intron	probably benign
R6825:Tlr5	UTSW	1	182973044	intron	probably benign
R6961:Tlr5	UTSW	1	182973511	nonsense	probably null
R7135:Tlr5	UTSW	1	182975523	missense	possibly damaging	0.87
R7232:Tlr5	UTSW	1	182973499	missense	probably benign	0.09
R7257:Tlr5	UTSW	1	182974233	nonsense	probably null
R8887:Tlr5	UTSW	1	182973767	missense	probably benign	0.07
R9116:Tlr5	UTSW	1	182974595	missense	probably benign
R9224:Tlr5	UTSW	1	182975128	missense	probably benign	0.10
R9284:Tlr5	UTSW	1	182973812	missense	probably benign	0.00
Z1177:Tlr5	UTSW	1	182973817	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACTGTTTGGGACACTGAAGG -3'
(R):5'- TCGGACAGGTTTTCTAGCCTG -3'

Sequencing Primer
(F):5'- TGAAGATGCTGAACCTTGCC -3'
(R):5'- GTTTTCAGATAACTCTAGGAAGTTGG -3'

Posted On

2019-06-26