Incidental Mutation 'R7255:Slc25a25'
ID 564180
Institutional Source Beutler Lab
Gene Symbol Slc25a25
Ensembl Gene ENSMUSG00000026819
Gene Name solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25
Synonyms 1110030N17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7255 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 32414487-32451445 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32421372 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 135 (E135G)
Ref Sequence ENSEMBL: ENSMUSP00000028160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028160] [ENSMUST00000052119] [ENSMUST00000113307] [ENSMUST00000113308] [ENSMUST00000113310] [ENSMUST00000136361] [ENSMUST00000153886]
AlphaFold A2ASZ8
Predicted Effect possibly damaging
Transcript: ENSMUST00000028160
AA Change: E135G

PolyPhen 2 Score 0.604 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028160
Gene: ENSMUSG00000026819
AA Change: E135G

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
EFh 48 76 8.73e0 SMART
EFh 84 112 2.64e-1 SMART
EFh 115 143 1.36e0 SMART
Blast:EFh 151 191 1e-9 BLAST
Pfam:Mito_carr 227 320 1.7e-26 PFAM
Pfam:Mito_carr 321 413 6.4e-26 PFAM
Pfam:Mito_carr 418 512 9.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052119
AA Change: E122G

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000060581
Gene: ENSMUSG00000026819
AA Change: E122G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EFh 71 99 4.53e0 SMART
EFh 102 130 1.36e0 SMART
Blast:EFh 138 178 2e-9 BLAST
Pfam:Mito_carr 214 307 1.2e-26 PFAM
Pfam:Mito_carr 308 400 2.5e-27 PFAM
Pfam:Mito_carr 405 500 4.9e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113307
AA Change: E102G

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108932
Gene: ENSMUSG00000026819
AA Change: E102G

DomainStartEndE-ValueType
EFh 51 79 9.51e0 SMART
EFh 82 110 1.36e0 SMART
EFh 118 146 8.82e1 SMART
Pfam:Mito_carr 182 275 1.1e-26 PFAM
Pfam:Mito_carr 276 368 2.2e-27 PFAM
Pfam:Mito_carr 373 468 4.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113308
AA Change: E122G

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108933
Gene: ENSMUSG00000026819
AA Change: E122G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EFh 71 99 4.53e0 SMART
EFh 102 130 1.36e0 SMART
EFh 138 166 8.82e1 SMART
Pfam:Mito_carr 202 295 1.1e-26 PFAM
Pfam:Mito_carr 296 388 2.4e-27 PFAM
Pfam:Mito_carr 393 488 4.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113310
AA Change: E135G

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108936
Gene: ENSMUSG00000026819
AA Change: E135G

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
EFh 48 76 8.73e0 SMART
EFh 84 112 2.64e-1 SMART
EFh 115 143 1.36e0 SMART
EFh 151 179 8.82e1 SMART
Pfam:Mito_carr 215 308 1.2e-26 PFAM
Pfam:Mito_carr 309 401 2.5e-27 PFAM
Pfam:Mito_carr 406 501 4.9e-21 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000121932
Gene: ENSMUSG00000026819
AA Change: E86G

DomainStartEndE-ValueType
EFh 36 64 8.99e0 SMART
EFh 67 95 1.36e0 SMART
Blast:EFh 103 143 1e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000136361
AA Change: E87G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115617
Gene: ENSMUSG00000026819
AA Change: E87G

DomainStartEndE-ValueType
EFh 36 64 8.99e0 SMART
EFh 67 95 1.36e0 SMART
EFh 103 131 8.82e1 SMART
Pfam:Mito_carr 167 260 9.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153886
SMART Domains Protein: ENSMUSP00000141486
Gene: ENSMUSG00000026819

DomainStartEndE-ValueType
SCOP:d1exra_ 1 38 1e-4 SMART
Blast:EFh 15 43 2e-13 BLAST
Pfam:Mito_carr 79 112 1.1e-7 PFAM
Meta Mutation Damage Score 0.9137 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of calcium-binding mitochondrial carriers, with a characteristic mitochondrial carrier domain at the C-terminus. These proteins are found in the inner membranes of mitochondria, and function as transport proteins. They shuttle metabolites, nucleotides and cofactors through the mitochondrial membrane and thereby connect and/or regulate cytoplasm and matrix functions. This protein may function as an ATP-Mg/Pi carrier that mediates the transport of Mg-ATP in exchange for phosphate, and likely responsible for the net uptake or efflux of adenine nucleotides into or from the mitochondria. Alternatively spliced transcript variants encoding different isoforms with a common C-terminus but variable N-termini have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced physical endurance and metabolic efficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G A 11: 23,620,465 P145L probably benign Het
9530003J23Rik T C 10: 117,234,422 H150R probably benign Het
Aldh1a7 A G 19: 20,714,728 S234P probably damaging Het
Arhgap28 T C 17: 67,853,004 H650R probably damaging Het
Asic1 A G 15: 99,697,457 D355G probably damaging Het
Atp8b1 T A 18: 64,556,868 S598C probably damaging Het
Bcat1 C A 6: 145,032,785 E237* probably null Het
Btbd16 A T 7: 130,785,992 I114F probably benign Het
Casp2 A G 6: 42,268,907 D166G probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cpsf1 G A 15: 76,597,543 T1099M probably damaging Het
Crisp4 C A 1: 18,130,231 A116S probably damaging Het
Cyb5r3 A G 15: 83,160,165 I168T probably damaging Het
Dip2b G A 15: 100,209,627 D1407N probably benign Het
Dnajc8 A G 4: 132,551,573 K201R probably benign Het
Dock10 C T 1: 80,543,099 probably null Het
Dopey2 C A 16: 93,770,146 H1272N probably damaging Het
Dsc1 C T 18: 20,097,273 R325Q probably benign Het
Enpp1 A T 10: 24,645,315 I838K possibly damaging Het
Fcna T G 2: 25,626,028 D159A probably damaging Het
Flnc G T 6: 29,445,766 G840C probably damaging Het
Flt1 C T 5: 147,580,406 A1024T probably damaging Het
Galc T C 12: 98,246,255 K207R probably null Het
Gbp2b T A 3: 142,608,117 L386Q probably damaging Het
Gm8297 T A 14: 4,984,874 N48K probably damaging Het
Gm9639 G A 10: 77,794,538 P180L unknown Het
Inpp5a A G 7: 139,511,448 N116S probably damaging Het
Ipo9 T C 1: 135,385,988 E984G probably benign Het
Klra4 A G 6: 130,059,642 F145L probably damaging Het
Lag3 A G 6: 124,910,235 L123P probably benign Het
Med7 T A 11: 46,440,995 M139K probably damaging Het
Mfsd2a A C 4: 122,952,021 L153R possibly damaging Het
Mup9 A G 4: 60,421,337 V71A probably benign Het
Myo16 A T 8: 10,499,169 Q927L unknown Het
Myo9b T C 8: 71,290,891 Y199H probably damaging Het
Nefm A G 14: 68,116,000 F406L probably benign Het
Olfr1123 T A 2: 87,418,942 L296Q probably damaging Het
Olfr1333 A T 4: 118,829,952 F162I probably benign Het
Pamr1 T C 2: 102,611,584 F173L probably damaging Het
Pds5b T A 5: 150,796,667 D1205E probably benign Het
Plxna2 T G 1: 194,752,103 F646V probably benign Het
Pnrc1 C T 4: 33,248,045 G118D probably benign Het
Ppp1r16b T C 2: 158,761,391 F412S probably benign Het
Prcc A T 3: 87,870,091 V192E probably damaging Het
Psg19 A G 7: 18,794,048 Y257H probably benign Het
Rfx7 T G 9: 72,619,828 S1433R possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Sbspon G T 1: 15,883,797 C86* probably null Het
Sdhb A G 4: 140,977,418 E230G possibly damaging Het
Sema6b T C 17: 56,125,336 T581A probably benign Het
Shkbp1 G T 7: 27,342,748 T594K possibly damaging Het
Shpk A G 11: 73,199,660 S48G probably benign Het
Slc1a3 A G 15: 8,642,999 V332A possibly damaging Het
Slc5a8 A T 10: 88,909,631 D367V probably damaging Het
Slco1c1 A G 6: 141,569,325 T649A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats1 T A 17: 45,454,205 D163V probably damaging Het
Ssh2 T A 11: 77,425,593 M304K probably damaging Het
Sulf1 T A 1: 12,859,008 D166E probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Tcf7l1 A T 6: 72,627,347 probably null Het
Tet1 A T 10: 62,822,636 M1477K probably benign Het
Tlr5 T C 1: 182,974,316 F395S probably damaging Het
Trrap T C 5: 144,858,954 L3847P probably damaging Het
Tsks C T 7: 44,952,688 S276L probably benign Het
Uggt1 T C 1: 36,146,106 E1519G probably damaging Het
Vps13a A G 19: 16,654,339 probably null Het
Wdfy4 A G 14: 32,974,282 V2768A Het
Wdr26 A C 1: 181,181,324 I627R probably benign Het
Zfp160 T A 17: 21,025,487 S100T probably benign Het
Other mutations in Slc25a25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Slc25a25 APN 2 32419160 missense probably benign 0.04
IGL01431:Slc25a25 APN 2 32419091 missense probably damaging 1.00
IGL02211:Slc25a25 APN 2 32417440 missense probably damaging 1.00
IGL02393:Slc25a25 APN 2 32417843 missense probably benign 0.40
R0385:Slc25a25 UTSW 2 32417822 missense probably damaging 0.99
R1208:Slc25a25 UTSW 2 32417425 missense probably benign 0.11
R1208:Slc25a25 UTSW 2 32417425 missense probably benign 0.11
R1611:Slc25a25 UTSW 2 32420379 missense probably damaging 1.00
R1960:Slc25a25 UTSW 2 32420651 splice site probably null
R2405:Slc25a25 UTSW 2 32417719 splice site probably null
R3749:Slc25a25 UTSW 2 32420380 missense probably benign 0.21
R4446:Slc25a25 UTSW 2 32430609 missense probably benign 0.00
R4815:Slc25a25 UTSW 2 32420410 missense probably damaging 1.00
R5245:Slc25a25 UTSW 2 32421328 nonsense probably null
R6884:Slc25a25 UTSW 2 32420662 missense probably benign 0.34
R7144:Slc25a25 UTSW 2 32419166 missense probably damaging 1.00
R7210:Slc25a25 UTSW 2 32420396 missense possibly damaging 0.89
R7667:Slc25a25 UTSW 2 32451209 missense probably benign 0.00
R7893:Slc25a25 UTSW 2 32451165 nonsense probably null
R8031:Slc25a25 UTSW 2 32421505 missense probably damaging 0.97
R8550:Slc25a25 UTSW 2 32416193 missense probably damaging 1.00
R9076:Slc25a25 UTSW 2 32419163 missense probably damaging 1.00
R9255:Slc25a25 UTSW 2 32420379 missense probably damaging 1.00
X0021:Slc25a25 UTSW 2 32421514 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGGAAGGGGCTTCTTATCC -3'
(R):5'- TGGGCAACTGGACTTTGAAG -3'

Sequencing Primer
(F):5'- TTATCCCTCCTCCTAAACACAGGG -3'
(R):5'- GCAACTGGACTTTGAAGAGTTTGTAC -3'
Posted On 2019-06-26