Incidental Mutation 'R7255:Olfr1123'
ID 564181
Institutional Source Beutler Lab
Gene Symbol Olfr1123
Ensembl Gene ENSMUSG00000043274
Gene Name olfactory receptor 1123
Synonyms MOR264-17, GA_x6K02T2Q125-48917235-48918206
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock # R7255 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 87416635-87423211 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 87418942 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 296 (L296Q)
Ref Sequence ENSEMBL: ENSMUSP00000154459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054974] [ENSMUST00000216208]
AlphaFold A2AT85
Predicted Effect probably damaging
Transcript: ENSMUST00000054974
AA Change: L298Q

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058786
Gene: ENSMUSG00000043274
AA Change: L298Q

DomainStartEndE-ValueType
Pfam:7tm_4 44 321 4.4e-52 PFAM
Pfam:7tm_1 54 303 2.6e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216208
AA Change: L296Q

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G A 11: 23,620,465 P145L probably benign Het
9530003J23Rik T C 10: 117,234,422 H150R probably benign Het
Aldh1a7 A G 19: 20,714,728 S234P probably damaging Het
Arhgap28 T C 17: 67,853,004 H650R probably damaging Het
Asic1 A G 15: 99,697,457 D355G probably damaging Het
Atp8b1 T A 18: 64,556,868 S598C probably damaging Het
Bcat1 C A 6: 145,032,785 E237* probably null Het
Btbd16 A T 7: 130,785,992 I114F probably benign Het
Casp2 A G 6: 42,268,907 D166G probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cpsf1 G A 15: 76,597,543 T1099M probably damaging Het
Crisp4 C A 1: 18,130,231 A116S probably damaging Het
Cyb5r3 A G 15: 83,160,165 I168T probably damaging Het
Dip2b G A 15: 100,209,627 D1407N probably benign Het
Dnajc8 A G 4: 132,551,573 K201R probably benign Het
Dock10 C T 1: 80,543,099 probably null Het
Dopey2 C A 16: 93,770,146 H1272N probably damaging Het
Dsc1 C T 18: 20,097,273 R325Q probably benign Het
Enpp1 A T 10: 24,645,315 I838K possibly damaging Het
Fcna T G 2: 25,626,028 D159A probably damaging Het
Flnc G T 6: 29,445,766 G840C probably damaging Het
Flt1 C T 5: 147,580,406 A1024T probably damaging Het
Galc T C 12: 98,246,255 K207R probably null Het
Gbp2b T A 3: 142,608,117 L386Q probably damaging Het
Gm8297 T A 14: 4,984,874 N48K probably damaging Het
Gm9639 G A 10: 77,794,538 P180L unknown Het
Inpp5a A G 7: 139,511,448 N116S probably damaging Het
Ipo9 T C 1: 135,385,988 E984G probably benign Het
Klra4 A G 6: 130,059,642 F145L probably damaging Het
Lag3 A G 6: 124,910,235 L123P probably benign Het
Med7 T A 11: 46,440,995 M139K probably damaging Het
Mfsd2a A C 4: 122,952,021 L153R possibly damaging Het
Mup9 A G 4: 60,421,337 V71A probably benign Het
Myo16 A T 8: 10,499,169 Q927L unknown Het
Myo9b T C 8: 71,290,891 Y199H probably damaging Het
Nefm A G 14: 68,116,000 F406L probably benign Het
Olfr1333 A T 4: 118,829,952 F162I probably benign Het
Pamr1 T C 2: 102,611,584 F173L probably damaging Het
Pds5b T A 5: 150,796,667 D1205E probably benign Het
Plxna2 T G 1: 194,752,103 F646V probably benign Het
Pnrc1 C T 4: 33,248,045 G118D probably benign Het
Ppp1r16b T C 2: 158,761,391 F412S probably benign Het
Prcc A T 3: 87,870,091 V192E probably damaging Het
Psg19 A G 7: 18,794,048 Y257H probably benign Het
Rfx7 T G 9: 72,619,828 S1433R possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Sbspon G T 1: 15,883,797 C86* probably null Het
Sdhb A G 4: 140,977,418 E230G possibly damaging Het
Sema6b T C 17: 56,125,336 T581A probably benign Het
Shkbp1 G T 7: 27,342,748 T594K possibly damaging Het
Shpk A G 11: 73,199,660 S48G probably benign Het
Slc1a3 A G 15: 8,642,999 V332A possibly damaging Het
Slc25a25 T C 2: 32,421,372 E135G possibly damaging Het
Slc5a8 A T 10: 88,909,631 D367V probably damaging Het
Slco1c1 A G 6: 141,569,325 T649A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats1 T A 17: 45,454,205 D163V probably damaging Het
Ssh2 T A 11: 77,425,593 M304K probably damaging Het
Sulf1 T A 1: 12,859,008 D166E probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Tcf7l1 A T 6: 72,627,347 probably null Het
Tet1 A T 10: 62,822,636 M1477K probably benign Het
Tlr5 T C 1: 182,974,316 F395S probably damaging Het
Trrap T C 5: 144,858,954 L3847P probably damaging Het
Tsks C T 7: 44,952,688 S276L probably benign Het
Uggt1 T C 1: 36,146,106 E1519G probably damaging Het
Vps13a A G 19: 16,654,339 probably null Het
Wdfy4 A G 14: 32,974,282 V2768A Het
Wdr26 A C 1: 181,181,324 I627R probably benign Het
Zfp160 T A 17: 21,025,487 S100T probably benign Het
Other mutations in Olfr1123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Olfr1123 APN 2 87418566 missense possibly damaging 0.75
IGL01067:Olfr1123 APN 2 87418370 missense probably benign 0.00
IGL01526:Olfr1123 APN 2 87418975 missense probably damaging 0.99
IGL01580:Olfr1123 APN 2 87418536 missense probably benign 0.06
IGL01986:Olfr1123 APN 2 87418536 missense probably benign 0.00
IGL02503:Olfr1123 APN 2 87418292 missense probably benign 0.03
IGL02527:Olfr1123 APN 2 87418837 missense probably damaging 1.00
IGL02731:Olfr1123 APN 2 87418707 missense probably benign 0.00
IGL03215:Olfr1123 APN 2 87418068 missense probably benign 0.05
IGL03366:Olfr1123 APN 2 87418243 missense possibly damaging 0.88
R0645:Olfr1123 UTSW 2 87418268 nonsense probably null
R1857:Olfr1123 UTSW 2 87418648 missense probably damaging 1.00
R2175:Olfr1123 UTSW 2 87418156 missense probably damaging 1.00
R3691:Olfr1123 UTSW 2 87418170 missense probably benign 0.20
R4082:Olfr1123 UTSW 2 87418457 nonsense probably null
R4635:Olfr1123 UTSW 2 87418699 missense probably benign 0.05
R4877:Olfr1123 UTSW 2 87418563 nonsense probably null
R5190:Olfr1123 UTSW 2 87418843 missense probably damaging 1.00
R5253:Olfr1123 UTSW 2 87418668 missense possibly damaging 0.64
R6266:Olfr1123 UTSW 2 87419006 missense probably benign 0.01
R6784:Olfr1123 UTSW 2 87418452 missense probably benign 0.20
R6909:Olfr1123 UTSW 2 87418615 missense probably damaging 1.00
R8076:Olfr1123 UTSW 2 87418545 missense probably benign 0.00
R8116:Olfr1123 UTSW 2 87418737 missense probably damaging 1.00
R8315:Olfr1123 UTSW 2 87418651 missense probably damaging 1.00
R8888:Olfr1123 UTSW 2 87418315 missense probably benign 0.00
R8895:Olfr1123 UTSW 2 87418315 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGAAACTGTCATCAGCCAAAG -3'
(R):5'- TGGAAGCCCTGTATTAAAGTGTG -3'

Sequencing Primer
(F):5'- GGAAGGACCAAAGCTTTCTCC -3'
(R):5'- TTGTAAGACAAAATGTAGGCGGTTAC -3'
Posted On 2019-06-26