Incidental Mutation 'R7255:Mfsd2a'
ID 564189
Institutional Source Beutler Lab
Gene Symbol Mfsd2a
Ensembl Gene ENSMUSG00000028655
Gene Name major facilitator superfamily domain containing 2A
Synonyms 1700018O18Rik, Mfsd2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock # R7255 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 122946850-122961188 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 122952021 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 153 (L153R)
Ref Sequence ENSEMBL: ENSMUSP00000030408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030408] [ENSMUST00000127047]
AlphaFold Q9DA75
Predicted Effect possibly damaging
Transcript: ENSMUST00000030408
AA Change: L153R

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030408
Gene: ENSMUSG00000028655
AA Change: L153R

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 27 39 N/A INTRINSIC
Pfam:MFS_2 44 500 1.7e-96 PFAM
Pfam:MFS_1 57 450 9.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127047
SMART Domains Protein: ENSMUSP00000116782
Gene: ENSMUSG00000028655

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
Pfam:MFS_2 42 106 2.7e-15 PFAM
Meta Mutation Damage Score 0.2215 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show partial postnatal lethality, reduced body weight, ataxia, and alterations in lipid metabolism and photoreceptor cell development. Homozygotes for a different null allele show a leaky blood-brain barrier and increased CNS-endothelial-cell vesicular transcytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G A 11: 23,620,465 P145L probably benign Het
9530003J23Rik T C 10: 117,234,422 H150R probably benign Het
Aldh1a7 A G 19: 20,714,728 S234P probably damaging Het
Arhgap28 T C 17: 67,853,004 H650R probably damaging Het
Asic1 A G 15: 99,697,457 D355G probably damaging Het
Atp8b1 T A 18: 64,556,868 S598C probably damaging Het
Bcat1 C A 6: 145,032,785 E237* probably null Het
Btbd16 A T 7: 130,785,992 I114F probably benign Het
Casp2 A G 6: 42,268,907 D166G probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cpsf1 G A 15: 76,597,543 T1099M probably damaging Het
Crisp4 C A 1: 18,130,231 A116S probably damaging Het
Cyb5r3 A G 15: 83,160,165 I168T probably damaging Het
Dip2b G A 15: 100,209,627 D1407N probably benign Het
Dnajc8 A G 4: 132,551,573 K201R probably benign Het
Dock10 C T 1: 80,543,099 probably null Het
Dopey2 C A 16: 93,770,146 H1272N probably damaging Het
Dsc1 C T 18: 20,097,273 R325Q probably benign Het
Enpp1 A T 10: 24,645,315 I838K possibly damaging Het
Fcna T G 2: 25,626,028 D159A probably damaging Het
Flnc G T 6: 29,445,766 G840C probably damaging Het
Flt1 C T 5: 147,580,406 A1024T probably damaging Het
Galc T C 12: 98,246,255 K207R probably null Het
Gbp2b T A 3: 142,608,117 L386Q probably damaging Het
Gm8297 T A 14: 4,984,874 N48K probably damaging Het
Gm9639 G A 10: 77,794,538 P180L unknown Het
Inpp5a A G 7: 139,511,448 N116S probably damaging Het
Ipo9 T C 1: 135,385,988 E984G probably benign Het
Klra4 A G 6: 130,059,642 F145L probably damaging Het
Lag3 A G 6: 124,910,235 L123P probably benign Het
Med7 T A 11: 46,440,995 M139K probably damaging Het
Mup9 A G 4: 60,421,337 V71A probably benign Het
Myo16 A T 8: 10,499,169 Q927L unknown Het
Myo9b T C 8: 71,290,891 Y199H probably damaging Het
Nefm A G 14: 68,116,000 F406L probably benign Het
Olfr1123 T A 2: 87,418,942 L296Q probably damaging Het
Olfr1333 A T 4: 118,829,952 F162I probably benign Het
Pamr1 T C 2: 102,611,584 F173L probably damaging Het
Pds5b T A 5: 150,796,667 D1205E probably benign Het
Plxna2 T G 1: 194,752,103 F646V probably benign Het
Pnrc1 C T 4: 33,248,045 G118D probably benign Het
Ppp1r16b T C 2: 158,761,391 F412S probably benign Het
Prcc A T 3: 87,870,091 V192E probably damaging Het
Psg19 A G 7: 18,794,048 Y257H probably benign Het
Rfx7 T G 9: 72,619,828 S1433R possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Sbspon G T 1: 15,883,797 C86* probably null Het
Sdhb A G 4: 140,977,418 E230G possibly damaging Het
Sema6b T C 17: 56,125,336 T581A probably benign Het
Shkbp1 G T 7: 27,342,748 T594K possibly damaging Het
Shpk A G 11: 73,199,660 S48G probably benign Het
Slc1a3 A G 15: 8,642,999 V332A possibly damaging Het
Slc25a25 T C 2: 32,421,372 E135G possibly damaging Het
Slc5a8 A T 10: 88,909,631 D367V probably damaging Het
Slco1c1 A G 6: 141,569,325 T649A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats1 T A 17: 45,454,205 D163V probably damaging Het
Ssh2 T A 11: 77,425,593 M304K probably damaging Het
Sulf1 T A 1: 12,859,008 D166E probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Tcf7l1 A T 6: 72,627,347 probably null Het
Tet1 A T 10: 62,822,636 M1477K probably benign Het
Tlr5 T C 1: 182,974,316 F395S probably damaging Het
Trrap T C 5: 144,858,954 L3847P probably damaging Het
Tsks C T 7: 44,952,688 S276L probably benign Het
Uggt1 T C 1: 36,146,106 E1519G probably damaging Het
Vps13a A G 19: 16,654,339 probably null Het
Wdfy4 A G 14: 32,974,282 V2768A Het
Wdr26 A C 1: 181,181,324 I627R probably benign Het
Zfp160 T A 17: 21,025,487 S100T probably benign Het
Other mutations in Mfsd2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Mfsd2a APN 4 122949307 missense probably benign 0.32
IGL02756:Mfsd2a APN 4 122948539 missense probably benign 0.30
azure UTSW 4 122952021 missense possibly damaging 0.66
R0355:Mfsd2a UTSW 4 122951839 missense possibly damaging 0.64
R0394:Mfsd2a UTSW 4 122950168 missense probably benign 0.26
R2002:Mfsd2a UTSW 4 122956816 missense probably damaging 1.00
R2516:Mfsd2a UTSW 4 122950487 missense probably damaging 1.00
R2943:Mfsd2a UTSW 4 122948589 missense possibly damaging 0.87
R3052:Mfsd2a UTSW 4 122951842 missense probably damaging 1.00
R4811:Mfsd2a UTSW 4 122959382 missense probably benign 0.28
R4977:Mfsd2a UTSW 4 122950509 missense probably benign
R5030:Mfsd2a UTSW 4 122950156 missense possibly damaging 0.90
R5231:Mfsd2a UTSW 4 122959301 missense possibly damaging 0.88
R5735:Mfsd2a UTSW 4 122949327 missense probably damaging 0.98
R6173:Mfsd2a UTSW 4 122951246 missense probably benign
R6321:Mfsd2a UTSW 4 122949372 missense probably benign 0.06
R6433:Mfsd2a UTSW 4 122950457 missense probably benign 0.01
R6736:Mfsd2a UTSW 4 122951261 missense probably benign
R6793:Mfsd2a UTSW 4 122950705 missense probably benign 0.02
R7073:Mfsd2a UTSW 4 122951295 missense possibly damaging 0.91
R7382:Mfsd2a UTSW 4 122952123 missense possibly damaging 0.53
R7868:Mfsd2a UTSW 4 122956855 missense possibly damaging 0.93
R8095:Mfsd2a UTSW 4 122951271 missense probably damaging 1.00
R8136:Mfsd2a UTSW 4 122951867 missense probably benign 0.27
R8140:Mfsd2a UTSW 4 122949298 missense probably benign 0.00
R8832:Mfsd2a UTSW 4 122949309 missense probably benign 0.01
R8842:Mfsd2a UTSW 4 122951830 missense probably damaging 0.98
R9048:Mfsd2a UTSW 4 122960975 missense probably benign
R9084:Mfsd2a UTSW 4 122950201 missense probably damaging 1.00
Z1176:Mfsd2a UTSW 4 122951839 missense probably benign 0.44
Z1176:Mfsd2a UTSW 4 122959311 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GATGAACATGGTGAGCGCTG -3'
(R):5'- GGGAGGGCTCATACTTCTTC -3'

Sequencing Primer
(F):5'- CATGGTGAGCGCTGAGTAG -3'
(R):5'- CCCGTTGATGGGCACTTG -3'
Posted On 2019-06-26