Incidental Mutation 'R7255:Sdhb'
ID 564191
Institutional Source Beutler Lab
Gene Symbol Sdhb
Ensembl Gene ENSMUSG00000009863
Gene Name succinate dehydrogenase complex, subunit B, iron sulfur (Ip)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7255 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 140961203-140979193 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 140977418 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 230 (E230G)
Ref Sequence ENSEMBL: ENSMUSP00000010007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010007]
AlphaFold Q9CQA3
Predicted Effect possibly damaging
Transcript: ENSMUST00000010007
AA Change: E230G

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000010007
Gene: ENSMUSG00000009863
AA Change: E230G

DomainStartEndE-ValueType
Pfam:Fer2_3 43 150 5e-36 PFAM
Pfam:Fer4_8 185 259 2.2e-9 PFAM
Pfam:Fer4_17 187 260 1.8e-11 PFAM
Pfam:Fer4_18 193 262 1e-9 PFAM
Meta Mutation Damage Score 0.0669 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Complex II of the respiratory chain, which is specifically involved in the oxidation of succinate, carries electrons from FADH to CoQ. The complex is composed of four nuclear-encoded subunits and is localized in the mitochondrial inner membrane. The iron-sulfur subunit is highly conserved and contains three cysteine-rich clusters which may comprise the iron-sulfur centers of the enzyme. Sporadic and familial mutations in this gene result in paragangliomas and pheochromocytoma, and support a link between mitochondrial dysfunction and tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: The gene is involved in the hypoxia-induced RNA editing pathway in monocytes. Heterozygous compound KOs show reduced increase in blood hemoglobin under hypoxic conditions. Homozygous inactivation of this gene results in complete embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G A 11: 23,620,465 P145L probably benign Het
9530003J23Rik T C 10: 117,234,422 H150R probably benign Het
Aldh1a7 A G 19: 20,714,728 S234P probably damaging Het
Arhgap28 T C 17: 67,853,004 H650R probably damaging Het
Asic1 A G 15: 99,697,457 D355G probably damaging Het
Atp8b1 T A 18: 64,556,868 S598C probably damaging Het
Bcat1 C A 6: 145,032,785 E237* probably null Het
Btbd16 A T 7: 130,785,992 I114F probably benign Het
Casp2 A G 6: 42,268,907 D166G probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cpsf1 G A 15: 76,597,543 T1099M probably damaging Het
Crisp4 C A 1: 18,130,231 A116S probably damaging Het
Cyb5r3 A G 15: 83,160,165 I168T probably damaging Het
Dip2b G A 15: 100,209,627 D1407N probably benign Het
Dnajc8 A G 4: 132,551,573 K201R probably benign Het
Dock10 C T 1: 80,543,099 probably null Het
Dopey2 C A 16: 93,770,146 H1272N probably damaging Het
Dsc1 C T 18: 20,097,273 R325Q probably benign Het
Enpp1 A T 10: 24,645,315 I838K possibly damaging Het
Fcna T G 2: 25,626,028 D159A probably damaging Het
Flnc G T 6: 29,445,766 G840C probably damaging Het
Flt1 C T 5: 147,580,406 A1024T probably damaging Het
Galc T C 12: 98,246,255 K207R probably null Het
Gbp2b T A 3: 142,608,117 L386Q probably damaging Het
Gm8297 T A 14: 4,984,874 N48K probably damaging Het
Gm9639 G A 10: 77,794,538 P180L unknown Het
Inpp5a A G 7: 139,511,448 N116S probably damaging Het
Ipo9 T C 1: 135,385,988 E984G probably benign Het
Klra4 A G 6: 130,059,642 F145L probably damaging Het
Lag3 A G 6: 124,910,235 L123P probably benign Het
Med7 T A 11: 46,440,995 M139K probably damaging Het
Mfsd2a A C 4: 122,952,021 L153R possibly damaging Het
Mup9 A G 4: 60,421,337 V71A probably benign Het
Myo16 A T 8: 10,499,169 Q927L unknown Het
Myo9b T C 8: 71,290,891 Y199H probably damaging Het
Nefm A G 14: 68,116,000 F406L probably benign Het
Olfr1123 T A 2: 87,418,942 L296Q probably damaging Het
Olfr1333 A T 4: 118,829,952 F162I probably benign Het
Pamr1 T C 2: 102,611,584 F173L probably damaging Het
Pds5b T A 5: 150,796,667 D1205E probably benign Het
Plxna2 T G 1: 194,752,103 F646V probably benign Het
Pnrc1 C T 4: 33,248,045 G118D probably benign Het
Ppp1r16b T C 2: 158,761,391 F412S probably benign Het
Prcc A T 3: 87,870,091 V192E probably damaging Het
Psg19 A G 7: 18,794,048 Y257H probably benign Het
Rfx7 T G 9: 72,619,828 S1433R possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Sbspon G T 1: 15,883,797 C86* probably null Het
Sema6b T C 17: 56,125,336 T581A probably benign Het
Shkbp1 G T 7: 27,342,748 T594K possibly damaging Het
Shpk A G 11: 73,199,660 S48G probably benign Het
Slc1a3 A G 15: 8,642,999 V332A possibly damaging Het
Slc25a25 T C 2: 32,421,372 E135G possibly damaging Het
Slc5a8 A T 10: 88,909,631 D367V probably damaging Het
Slco1c1 A G 6: 141,569,325 T649A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats1 T A 17: 45,454,205 D163V probably damaging Het
Ssh2 T A 11: 77,425,593 M304K probably damaging Het
Sulf1 T A 1: 12,859,008 D166E probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Tcf7l1 A T 6: 72,627,347 probably null Het
Tet1 A T 10: 62,822,636 M1477K probably benign Het
Tlr5 T C 1: 182,974,316 F395S probably damaging Het
Trrap T C 5: 144,858,954 L3847P probably damaging Het
Tsks C T 7: 44,952,688 S276L probably benign Het
Uggt1 T C 1: 36,146,106 E1519G probably damaging Het
Vps13a A G 19: 16,654,339 probably null Het
Wdfy4 A G 14: 32,974,282 V2768A Het
Wdr26 A C 1: 181,181,324 I627R probably benign Het
Zfp160 T A 17: 21,025,487 S100T probably benign Het
Other mutations in Sdhb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Sdhb APN 4 140977480 missense probably damaging 1.00
IGL01542:Sdhb APN 4 140972967 missense probably benign
IGL01790:Sdhb APN 4 140973727 missense probably benign
IGL03003:Sdhb APN 4 140973000 missense probably damaging 1.00
R1070:Sdhb UTSW 4 140971236 splice site probably benign
R1971:Sdhb UTSW 4 140972949 missense possibly damaging 0.81
R2008:Sdhb UTSW 4 140979029 missense probably damaging 1.00
R2358:Sdhb UTSW 4 140973000 missense probably damaging 1.00
R3821:Sdhb UTSW 4 140979088 nonsense probably null
R4202:Sdhb UTSW 4 140979068 missense possibly damaging 0.64
R4611:Sdhb UTSW 4 140972915 missense probably damaging 1.00
R4782:Sdhb UTSW 4 140977466 missense possibly damaging 0.59
R4799:Sdhb UTSW 4 140977466 missense possibly damaging 0.59
R6235:Sdhb UTSW 4 140973673 missense probably damaging 0.98
R6426:Sdhb UTSW 4 140973718 missense probably benign 0.01
R6768:Sdhb UTSW 4 140979053 missense probably damaging 1.00
R6787:Sdhb UTSW 4 140976190 missense probably damaging 1.00
R7520:Sdhb UTSW 4 140966571 missense possibly damaging 0.88
R9335:Sdhb UTSW 4 140972939 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATGAAAGGTGCTGACGC -3'
(R):5'- TGGAGTCTGTGACTGAGAGAGC -3'

Sequencing Primer
(F):5'- TCAAAGGCTCATGGACACCTGG -3'
(R):5'- TCTGTGACTGAGAGAGCCATTCC -3'
Posted On 2019-06-26