Mutagenetix > Incidental Mutations

Incidental Mutation 'R7255:Trrap'

564192

Institutional Source

Beutler Lab

Gene Symbol

Trrap

Ensembl Gene

ENSMUSG00000045482

Gene Name

transformation/transcription domain-associated protein

Synonyms

transactivation/transformation-domain associated protein

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7255 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

144767732-144859778 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 144858954 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 3847 (L3847P)

Ref Sequence

ENSEMBL: ENSMUSP00000098035 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000213013]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000038980
AA Change: L3829P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482
AA Change: L3829P

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1664	2e-6	SMART
low complexity region	1832	1843	N/A	INTRINSIC
low complexity region	1866	1881	N/A	INTRINSIC
low complexity region	2289	2303	N/A	INTRINSIC
Pfam:FAT	2830	3174	4.7e-69	PFAM
low complexity region	3363	3376	N/A	INTRINSIC
low complexity region	3407	3418	N/A	INTRINSIC
PI3Kc	3509	3798	5.11e-8	SMART
FATC	3797	3829	1.89e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000094120
AA Change: L3858P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482
AA Change: L3858P

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1682	2e-6	SMART
low complexity region	1850	1861	N/A	INTRINSIC
low complexity region	1884	1899	N/A	INTRINSIC
low complexity region	2307	2321	N/A	INTRINSIC
Pfam:FAT	2848	3203	1.1e-68	PFAM
low complexity region	3392	3405	N/A	INTRINSIC
low complexity region	3436	3447	N/A	INTRINSIC
PI3Kc	3538	3827	5.11e-8	SMART
FATC	3826	3858	1.89e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000100467
AA Change: L3847P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482
AA Change: L3847P

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1664	2e-6	SMART
low complexity region	1832	1843	N/A	INTRINSIC
low complexity region	1866	1881	N/A	INTRINSIC
low complexity region	2289	2303	N/A	INTRINSIC
Pfam:FAT	2830	3174	4.7e-69	PFAM
low complexity region	3381	3394	N/A	INTRINSIC
low complexity region	3425	3436	N/A	INTRINSIC
PI3Kc	3527	3816	5.11e-8	SMART
FATC	3815	3847	1.89e-3	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000122021
Gene: ENSMUSG00000045482
AA Change: L3586P

Domain	Start	End	E-Value	Type
low complexity region	197	242	N/A	INTRINSIC
low complexity region	244	255	N/A	INTRINSIC
SCOP:d1gw5a_	474	1003	9e-7	SMART
Blast:PI3Kc	480	579	1e-13	BLAST
low complexity region	1083	1092	N/A	INTRINSIC
low complexity region	1572	1583	N/A	INTRINSIC
low complexity region	1606	1621	N/A	INTRINSIC
low complexity region	2029	2043	N/A	INTRINSIC
Pfam:FAT	2570	2914	1.5e-69	PFAM
low complexity region	3121	3134	N/A	INTRINSIC
low complexity region	3165	3176	N/A	INTRINSIC
PI3Kc	3267	3556	5.11e-8	SMART
FATC	3555	3587	1.89e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000213013
AA Change: L3859P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	G	A	11: 23,620,465	P145L	probably benign	Het
9530003J23Rik	T	C	10: 117,234,422	H150R	probably benign	Het
Aldh1a7	A	G	19: 20,714,728	S234P	probably damaging	Het
Arhgap28	T	C	17: 67,853,004	H650R	probably damaging	Het
Asic1	A	G	15: 99,697,457	D355G	probably damaging	Het
Atp8b1	T	A	18: 64,556,868	S598C	probably damaging	Het
Bcat1	C	A	6: 145,032,785	E237*	probably null	Het
Btbd16	A	T	7: 130,785,992	I114F	probably benign	Het
Casp2	A	G	6: 42,268,907	D166G	probably damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cpsf1	G	A	15: 76,597,543	T1099M	probably damaging	Het
Crisp4	C	A	1: 18,130,231	A116S	probably damaging	Het
Cyb5r3	A	G	15: 83,160,165	I168T	probably damaging	Het
Dip2b	G	A	15: 100,209,627	D1407N	probably benign	Het
Dnajc8	A	G	4: 132,551,573	K201R	probably benign	Het
Dock10	C	T	1: 80,543,099		probably null	Het
Dopey2	C	A	16: 93,770,146	H1272N	probably damaging	Het
Dsc1	C	T	18: 20,097,273	R325Q	probably benign	Het
Enpp1	A	T	10: 24,645,315	I838K	possibly damaging	Het
Fcna	T	G	2: 25,626,028	D159A	probably damaging	Het
Flnc	G	T	6: 29,445,766	G840C	probably damaging	Het
Flt1	C	T	5: 147,580,406	A1024T	probably damaging	Het
Galc	T	C	12: 98,246,255	K207R	probably null	Het
Gbp2b	T	A	3: 142,608,117	L386Q	probably damaging	Het
Gm8297	T	A	14: 4,984,874	N48K	probably damaging	Het
Gm9639	G	A	10: 77,794,538	P180L	unknown	Het
Inpp5a	A	G	7: 139,511,448	N116S	probably damaging	Het
Ipo9	T	C	1: 135,385,988	E984G	probably benign	Het
Klra4	A	G	6: 130,059,642	F145L	probably damaging	Het
Lag3	A	G	6: 124,910,235	L123P	probably benign	Het
Med7	T	A	11: 46,440,995	M139K	probably damaging	Het
Mfsd2a	A	C	4: 122,952,021	L153R	possibly damaging	Het
Mup9	A	G	4: 60,421,337	V71A	probably benign	Het
Myo16	A	T	8: 10,499,169	Q927L	unknown	Het
Myo9b	T	C	8: 71,290,891	Y199H	probably damaging	Het
Nefm	A	G	14: 68,116,000	F406L	probably benign	Het
Olfr1123	T	A	2: 87,418,942	L296Q	probably damaging	Het
Olfr1333	A	T	4: 118,829,952	F162I	probably benign	Het
Pamr1	T	C	2: 102,611,584	F173L	probably damaging	Het
Pds5b	T	A	5: 150,796,667	D1205E	probably benign	Het
Plxna2	T	G	1: 194,752,103	F646V	probably benign	Het
Pnrc1	C	T	4: 33,248,045	G118D	probably benign	Het
Ppp1r16b	T	C	2: 158,761,391	F412S	probably benign	Het
Prcc	A	T	3: 87,870,091	V192E	probably damaging	Het
Psg19	A	G	7: 18,794,048	Y257H	probably benign	Het
Rfx7	T	G	9: 72,619,828	S1433R	possibly damaging	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Sbspon	G	T	1: 15,883,797	C86*	probably null	Het
Sdhb	A	G	4: 140,977,418	E230G	possibly damaging	Het
Sema6b	T	C	17: 56,125,336	T581A	probably benign	Het
Shkbp1	G	T	7: 27,342,748	T594K	possibly damaging	Het
Shpk	A	G	11: 73,199,660	S48G	probably benign	Het
Slc1a3	A	G	15: 8,642,999	V332A	possibly damaging	Het
Slc25a25	T	C	2: 32,421,372	E135G	possibly damaging	Het
Slc5a8	A	T	10: 88,909,631	D367V	probably damaging	Het
Slco1c1	A	G	6: 141,569,325	T649A	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spats1	T	A	17: 45,454,205	D163V	probably damaging	Het
Ssh2	T	A	11: 77,425,593	M304K	probably damaging	Het
Sulf1	T	A	1: 12,859,008	D166E	probably benign	Het
Syne1	A	G	10: 5,333,446	S1540P	probably damaging	Het
Tcf7l1	A	T	6: 72,627,347		probably null	Het
Tet1	A	T	10: 62,822,636	M1477K	probably benign	Het
Tlr5	T	C	1: 182,974,316	F395S	probably damaging	Het
Tsks	C	T	7: 44,952,688	S276L	probably benign	Het
Uggt1	T	C	1: 36,146,106	E1519G	probably damaging	Het
Vps13a	A	G	19: 16,654,339		probably null	Het
Wdfy4	A	G	14: 32,974,282	V2768A		Het
Wdr26	A	C	1: 181,181,324	I627R	probably benign	Het
Zfp160	T	A	17: 21,025,487	S100T	probably benign	Het

Other mutations in Trrap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Trrap	APN	5	144779974	splice site	probably benign
IGL00470:Trrap	APN	5	144818038	missense	probably damaging	1.00
IGL00490:Trrap	APN	5	144825225	missense	probably benign	0.40
IGL01072:Trrap	APN	5	144784255	splice site	probably benign
IGL01087:Trrap	APN	5	144846539	missense	probably damaging	0.99
IGL01300:Trrap	APN	5	144804818	missense	probably damaging	1.00
IGL01350:Trrap	APN	5	144830969	missense	possibly damaging	0.92
IGL01410:Trrap	APN	5	144831021	missense	probably benign	0.00
IGL01571:Trrap	APN	5	144833287	splice site	probably benign
IGL01748:Trrap	APN	5	144833340	missense	probably damaging	1.00
IGL01839:Trrap	APN	5	144821875	missense	probably damaging	1.00
IGL01976:Trrap	APN	5	144856989	missense	probably benign	0.00
IGL02075:Trrap	APN	5	144828494	missense	probably benign	0.00
IGL02127:Trrap	APN	5	144816433	missense	probably benign	0.22
IGL02131:Trrap	APN	5	144840436	missense	probably damaging	1.00
IGL02287:Trrap	APN	5	144832538	missense	probably damaging	1.00
IGL02301:Trrap	APN	5	144777917	missense	probably benign	0.05
IGL02336:Trrap	APN	5	144798390	missense	probably benign	0.39
IGL02526:Trrap	APN	5	144824550	missense	probably benign	0.00
IGL02873:Trrap	APN	5	144841079	splice site	probably benign
IGL02953:Trrap	APN	5	144815964	missense	probably damaging	0.99
IGL03404:Trrap	APN	5	144833186	missense	probably benign	0.00
Buffer	UTSW	5	144834204	missense	probably benign	0.06
Card-tower	UTSW	5	144804766	missense	probably damaging	1.00
Cookie	UTSW	5	144794049	missense	probably damaging	1.00
Glass_house	UTSW	5	144845477	missense	possibly damaging	0.67
Immovable	UTSW	5	144790855	missense	possibly damaging	0.66
R5049_trrap_520	UTSW	5	144826717	missense	probably damaging	1.00
R7167_Trrap_977	UTSW	5	144839614	missense	probably benign	0.39
vitreous	UTSW	5	144805727	missense	probably damaging	1.00
PIT4243001:Trrap	UTSW	5	144796971	missense	probably benign	0.00
PIT4466001:Trrap	UTSW	5	144828600	missense	probably benign	0.02
R0062:Trrap	UTSW	5	144782193	splice site	probably benign
R0062:Trrap	UTSW	5	144782193	splice site	probably benign
R0112:Trrap	UTSW	5	144822761	nonsense	probably null
R0126:Trrap	UTSW	5	144805750	nonsense	probably null
R0257:Trrap	UTSW	5	144804235	missense	probably benign	0.31
R0325:Trrap	UTSW	5	144816395	missense	probably benign	0.05
R0376:Trrap	UTSW	5	144816339	missense	probably benign	0.03
R0396:Trrap	UTSW	5	144814556	missense	probably damaging	0.99
R0448:Trrap	UTSW	5	144839567	missense	possibly damaging	0.66
R0454:Trrap	UTSW	5	144846477	missense	probably damaging	1.00
R0711:Trrap	UTSW	5	144853499	missense	probably damaging	1.00
R0827:Trrap	UTSW	5	144814830	missense	probably benign	0.00
R1005:Trrap	UTSW	5	144805727	missense	probably damaging	1.00
R1147:Trrap	UTSW	5	144804766	missense	probably damaging	1.00
R1147:Trrap	UTSW	5	144804766	missense	probably damaging	1.00
R1179:Trrap	UTSW	5	144777939	missense	possibly damaging	0.94
R1218:Trrap	UTSW	5	144816409	missense	probably damaging	1.00
R1264:Trrap	UTSW	5	144789599	splice site	probably benign
R1374:Trrap	UTSW	5	144846618	missense	probably damaging	1.00
R1401:Trrap	UTSW	5	144857422	missense	possibly damaging	0.93
R1480:Trrap	UTSW	5	144818313	missense	probably benign
R1538:Trrap	UTSW	5	144837202	missense	possibly damaging	0.65
R1751:Trrap	UTSW	5	144814575	critical splice donor site	probably null
R1779:Trrap	UTSW	5	144828590	missense	probably benign	0.01
R1782:Trrap	UTSW	5	144822703	missense	possibly damaging	0.93
R1792:Trrap	UTSW	5	144853586	missense	possibly damaging	0.87
R1859:Trrap	UTSW	5	144830951	missense	probably benign	0.04
R1861:Trrap	UTSW	5	144815917	splice site	probably null
R1902:Trrap	UTSW	5	144816053	missense	probably damaging	1.00
R1903:Trrap	UTSW	5	144816053	missense	probably damaging	1.00
R2021:Trrap	UTSW	5	144853488	missense	possibly damaging	0.94
R2026:Trrap	UTSW	5	144803044	missense	possibly damaging	0.86
R2036:Trrap	UTSW	5	144828562	missense	probably benign	0.08
R2099:Trrap	UTSW	5	144782239	missense	possibly damaging	0.46
R2108:Trrap	UTSW	5	144825874	missense	probably benign	0.01
R2113:Trrap	UTSW	5	144844211	missense	probably damaging	1.00
R2174:Trrap	UTSW	5	144821855	missense	probably benign	0.40
R2442:Trrap	UTSW	5	144817966	missense	probably damaging	1.00
R2568:Trrap	UTSW	5	144843369	critical splice donor site	probably null
R3442:Trrap	UTSW	5	144792252	missense	probably benign	0.03
R3853:Trrap	UTSW	5	144792165	missense	probably damaging	1.00
R4401:Trrap	UTSW	5	144843318	missense	possibly damaging	0.60
R4493:Trrap	UTSW	5	144831048	missense	probably benign	0.21
R4524:Trrap	UTSW	5	144825321	missense	probably benign	0.38
R4569:Trrap	UTSW	5	144792118	missense	probably benign	0.13
R4672:Trrap	UTSW	5	144785480	missense	probably damaging	0.97
R4732:Trrap	UTSW	5	144816570	missense	probably damaging	1.00
R4733:Trrap	UTSW	5	144816570	missense	probably damaging	1.00
R4791:Trrap	UTSW	5	144803277	missense	probably damaging	1.00
R4795:Trrap	UTSW	5	144832488	missense	probably benign	0.06
R4827:Trrap	UTSW	5	144800948	missense	probably benign	0.02
R4839:Trrap	UTSW	5	144845592	missense	probably damaging	1.00
R4915:Trrap	UTSW	5	144805735	missense	probably damaging	0.99
R4951:Trrap	UTSW	5	144805720	missense	possibly damaging	0.65
R4959:Trrap	UTSW	5	144856960	missense	probably damaging	1.00
R5049:Trrap	UTSW	5	144826717	missense	probably damaging	1.00
R5074:Trrap	UTSW	5	144851179	missense	probably damaging	1.00
R5236:Trrap	UTSW	5	144817786	missense	probably benign	0.07
R5281:Trrap	UTSW	5	144813503	missense	probably benign	0.13
R5322:Trrap	UTSW	5	144844224	missense	probably damaging	1.00
R5457:Trrap	UTSW	5	144849977	missense	probably damaging	1.00
R5590:Trrap	UTSW	5	144782265	missense	probably benign	0.05
R5799:Trrap	UTSW	5	144830945	missense	probably benign
R5885:Trrap	UTSW	5	144794793	missense	probably damaging	1.00
R5905:Trrap	UTSW	5	144849920	missense	possibly damaging	0.95
R5908:Trrap	UTSW	5	144786708	missense	probably damaging	0.96
R5956:Trrap	UTSW	5	144807391	splice site	silent
R5992:Trrap	UTSW	5	144810184	missense	probably benign	0.00
R6017:Trrap	UTSW	5	144844241	missense	probably damaging	1.00
R6029:Trrap	UTSW	5	144817679	missense	possibly damaging	0.94
R6029:Trrap	UTSW	5	144825914	missense	possibly damaging	0.75
R6117:Trrap	UTSW	5	144802961	missense	possibly damaging	0.78
R6166:Trrap	UTSW	5	144781981	missense	possibly damaging	0.66
R6234:Trrap	UTSW	5	144839713	splice site	probably null
R6288:Trrap	UTSW	5	144811992	missense	probably damaging	1.00
R6290:Trrap	UTSW	5	144805018	missense	probably damaging	1.00
R6316:Trrap	UTSW	5	144813526	missense	probably benign	0.02
R6398:Trrap	UTSW	5	144790870	missense	possibly damaging	0.83
R6413:Trrap	UTSW	5	144784046	missense	possibly damaging	0.83
R6499:Trrap	UTSW	5	144857002	missense	probably damaging	1.00
R6529:Trrap	UTSW	5	144834204	missense	probably benign	0.06
R6574:Trrap	UTSW	5	144815550	critical splice donor site	probably null
R6631:Trrap	UTSW	5	144771650	missense	possibly damaging	0.94
R6727:Trrap	UTSW	5	144856950	missense	probably damaging	1.00
R6776:Trrap	UTSW	5	144851256	nonsense	probably null
R6914:Trrap	UTSW	5	144784043	missense	possibly damaging	0.83
R6942:Trrap	UTSW	5	144784043	missense	possibly damaging	0.83
R6945:Trrap	UTSW	5	144790855	missense	possibly damaging	0.66
R7023:Trrap	UTSW	5	144792154	missense	possibly damaging	0.64
R7107:Trrap	UTSW	5	144797135	missense	probably benign	0.05
R7139:Trrap	UTSW	5	144803178	missense	possibly damaging	0.65
R7148:Trrap	UTSW	5	144821803	missense	possibly damaging	0.77
R7167:Trrap	UTSW	5	144839614	missense	probably benign	0.39
R7171:Trrap	UTSW	5	144794049	missense	probably damaging	1.00
R7205:Trrap	UTSW	5	144842707	missense	possibly damaging	0.94
R7215:Trrap	UTSW	5	144797135	missense	probably benign	0.05
R7261:Trrap	UTSW	5	144845477	missense	possibly damaging	0.67
R7264:Trrap	UTSW	5	144814523	missense	probably benign	0.05
R7372:Trrap	UTSW	5	144789398	missense	probably benign
R7447:Trrap	UTSW	5	144839474	missense	probably damaging	0.97
R7449:Trrap	UTSW	5	144851209	missense	probably damaging	1.00
R7655:Trrap	UTSW	5	144842612	missense	probably damaging	1.00
R7656:Trrap	UTSW	5	144842612	missense	probably damaging	1.00
R7662:Trrap	UTSW	5	144832511	missense	probably benign	0.00
R7716:Trrap	UTSW	5	144777146	missense	possibly damaging	0.73
R8143:Trrap	UTSW	5	144835897	splice site	probably null
R8183:Trrap	UTSW	5	144828533	missense	probably benign	0.01
R8265:Trrap	UTSW	5	144785534	missense	possibly damaging	0.53
R8273:Trrap	UTSW	5	144791165	missense	probably damaging	1.00
R8556:Trrap	UTSW	5	144825937	missense	probably benign	0.44
R8674:Trrap	UTSW	5	144791032	missense	probably benign	0.02
R8777:Trrap	UTSW	5	144837139	missense	probably benign	0.10
R8777-TAIL:Trrap	UTSW	5	144837139	missense	probably benign	0.10
R8817:Trrap	UTSW	5	144845538	missense	probably damaging	1.00
R8841:Trrap	UTSW	5	144844211	missense	probably damaging	1.00
R8871:Trrap	UTSW	5	144821839	missense	probably benign	0.30
R8937:Trrap	UTSW	5	144820253	missense	probably damaging	1.00
R8966:Trrap	UTSW	5	144803352	missense	probably damaging	0.96
R9010:Trrap	UTSW	5	144846416	missense	probably damaging	1.00
R9095:Trrap	UTSW	5	144797151	missense	probably damaging	1.00
R9127:Trrap	UTSW	5	144831020	missense	probably benign	0.16
R9132:Trrap	UTSW	5	144789552	missense	probably benign	0.03
R9224:Trrap	UTSW	5	144771239	missense	possibly damaging	0.70
R9338:Trrap	UTSW	5	144791115	missense	probably benign
R9380:Trrap	UTSW	5	144833171	missense	probably benign
R9404:Trrap	UTSW	5	144815415	missense	possibly damaging	0.85
R9457:Trrap	UTSW	5	144826668	missense	probably damaging	1.00
R9464:Trrap	UTSW	5	144826707	missense	probably damaging	0.99
X0060:Trrap	UTSW	5	144843361	missense	probably damaging	0.96
Z1088:Trrap	UTSW	5	144834197	missense	probably benign	0.00
Z1177:Trrap	UTSW	5	144810344	missense
Z1177:Trrap	UTSW	5	144819708	missense	probably damaging	1.00
Z1177:Trrap	UTSW	5	144856951	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCCTGAGAACATGGACAG -3'
(R):5'- TCGGAAGCTGCTGAGTTCAG -3'

Sequencing Primer
(F):5'- ACAACTTGGCCCAATTCG -3'
(R):5'- GAGTTCAGCTCTGCCATCG -3'

Posted On

2019-06-26