Incidental Mutation 'R7255:Slco1c1'
ID 564199
Institutional Source Beutler Lab
Gene Symbol Slco1c1
Ensembl Gene ENSMUSG00000030235
Gene Name solute carrier organic anion transporter family, member 1c1
Synonyms Slc21a14, OATP-F
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R7255 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 141524368-141570177 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 141569325 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 649 (T649A)
Ref Sequence ENSEMBL: ENSMUSP00000032362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032362] [ENSMUST00000135562] [ENSMUST00000203140] [ENSMUST00000204998] [ENSMUST00000205214]
AlphaFold Q9ERB5
Predicted Effect probably benign
Transcript: ENSMUST00000032362
AA Change: T649A

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000032362
Gene: ENSMUSG00000030235
AA Change: T649A

DomainStartEndE-ValueType
low complexity region 134 148 N/A INTRINSIC
low complexity region 152 168 N/A INTRINSIC
Pfam:MFS_1 181 464 1.1e-19 PFAM
KAZAL 478 518 1.21e0 SMART
transmembrane domain 644 666 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135562
SMART Domains Protein: ENSMUSP00000138093
Gene: ENSMUSG00000030235

DomainStartEndE-ValueType
Pfam:OATP 42 469 2.1e-135 PFAM
Pfam:Sugar_tr 175 460 2.9e-7 PFAM
Pfam:MFS_1 181 463 3.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203140
SMART Domains Protein: ENSMUSP00000145058
Gene: ENSMUSG00000030235

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
Pfam:MFS_1 63 346 2e-18 PFAM
KAZAL 360 400 7.8e-3 SMART
transmembrane domain 437 459 N/A INTRINSIC
transmembrane domain 474 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204998
Predicted Effect probably benign
Transcript: ENSMUST00000205214
AA Change: T600A

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000144889
Gene: ENSMUSG00000030235
AA Change: T600A

DomainStartEndE-ValueType
Pfam:OATP 44 176 1.3e-35 PFAM
Pfam:MFS_1 169 415 1.1e-10 PFAM
KAZAL 429 469 7.8e-3 SMART
transmembrane domain 509 531 N/A INTRINSIC
transmembrane domain 544 566 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic anion transporter family. The encoded protein is a transmembrane receptor that mediates the sodium-independent uptake of thyroid hormones in brain tissues. This protein has particularly high affinity for the thyroid hormones thyroxine, tri-iodothyronine and reverse tri-iodothyronine. Polymorphisms in the gene encoding this protein may be associated with fatigue and depression in patients suffering from hyperthyroidism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased thyroxine and triiodothyronine levels in the forebrain, in the absence of overt growth, reproductive or neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G A 11: 23,620,465 P145L probably benign Het
9530003J23Rik T C 10: 117,234,422 H150R probably benign Het
Aldh1a7 A G 19: 20,714,728 S234P probably damaging Het
Arhgap28 T C 17: 67,853,004 H650R probably damaging Het
Asic1 A G 15: 99,697,457 D355G probably damaging Het
Atp8b1 T A 18: 64,556,868 S598C probably damaging Het
Bcat1 C A 6: 145,032,785 E237* probably null Het
Btbd16 A T 7: 130,785,992 I114F probably benign Het
Casp2 A G 6: 42,268,907 D166G probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cpsf1 G A 15: 76,597,543 T1099M probably damaging Het
Crisp4 C A 1: 18,130,231 A116S probably damaging Het
Cyb5r3 A G 15: 83,160,165 I168T probably damaging Het
Dip2b G A 15: 100,209,627 D1407N probably benign Het
Dnajc8 A G 4: 132,551,573 K201R probably benign Het
Dock10 C T 1: 80,543,099 probably null Het
Dopey2 C A 16: 93,770,146 H1272N probably damaging Het
Dsc1 C T 18: 20,097,273 R325Q probably benign Het
Enpp1 A T 10: 24,645,315 I838K possibly damaging Het
Fcna T G 2: 25,626,028 D159A probably damaging Het
Flnc G T 6: 29,445,766 G840C probably damaging Het
Flt1 C T 5: 147,580,406 A1024T probably damaging Het
Galc T C 12: 98,246,255 K207R probably null Het
Gbp2b T A 3: 142,608,117 L386Q probably damaging Het
Gm8297 T A 14: 4,984,874 N48K probably damaging Het
Gm9639 G A 10: 77,794,538 P180L unknown Het
Inpp5a A G 7: 139,511,448 N116S probably damaging Het
Ipo9 T C 1: 135,385,988 E984G probably benign Het
Klra4 A G 6: 130,059,642 F145L probably damaging Het
Lag3 A G 6: 124,910,235 L123P probably benign Het
Med7 T A 11: 46,440,995 M139K probably damaging Het
Mfsd2a A C 4: 122,952,021 L153R possibly damaging Het
Mup9 A G 4: 60,421,337 V71A probably benign Het
Myo16 A T 8: 10,499,169 Q927L unknown Het
Myo9b T C 8: 71,290,891 Y199H probably damaging Het
Nefm A G 14: 68,116,000 F406L probably benign Het
Olfr1123 T A 2: 87,418,942 L296Q probably damaging Het
Olfr1333 A T 4: 118,829,952 F162I probably benign Het
Pamr1 T C 2: 102,611,584 F173L probably damaging Het
Pds5b T A 5: 150,796,667 D1205E probably benign Het
Plxna2 T G 1: 194,752,103 F646V probably benign Het
Pnrc1 C T 4: 33,248,045 G118D probably benign Het
Ppp1r16b T C 2: 158,761,391 F412S probably benign Het
Prcc A T 3: 87,870,091 V192E probably damaging Het
Psg19 A G 7: 18,794,048 Y257H probably benign Het
Rfx7 T G 9: 72,619,828 S1433R possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Sbspon G T 1: 15,883,797 C86* probably null Het
Sdhb A G 4: 140,977,418 E230G possibly damaging Het
Sema6b T C 17: 56,125,336 T581A probably benign Het
Shkbp1 G T 7: 27,342,748 T594K possibly damaging Het
Shpk A G 11: 73,199,660 S48G probably benign Het
Slc1a3 A G 15: 8,642,999 V332A possibly damaging Het
Slc25a25 T C 2: 32,421,372 E135G possibly damaging Het
Slc5a8 A T 10: 88,909,631 D367V probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats1 T A 17: 45,454,205 D163V probably damaging Het
Ssh2 T A 11: 77,425,593 M304K probably damaging Het
Sulf1 T A 1: 12,859,008 D166E probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Tcf7l1 A T 6: 72,627,347 probably null Het
Tet1 A T 10: 62,822,636 M1477K probably benign Het
Tlr5 T C 1: 182,974,316 F395S probably damaging Het
Trrap T C 5: 144,858,954 L3847P probably damaging Het
Tsks C T 7: 44,952,688 S276L probably benign Het
Uggt1 T C 1: 36,146,106 E1519G probably damaging Het
Vps13a A G 19: 16,654,339 probably null Het
Wdfy4 A G 14: 32,974,282 V2768A Het
Wdr26 A C 1: 181,181,324 I627R probably benign Het
Zfp160 T A 17: 21,025,487 S100T probably benign Het
Other mutations in Slco1c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Slco1c1 APN 6 141569482 missense probably benign 0.00
IGL00766:Slco1c1 APN 6 141547883 missense probably damaging 1.00
IGL00825:Slco1c1 APN 6 141542142 missense probably damaging 1.00
IGL01380:Slco1c1 APN 6 141540051 missense probably damaging 1.00
IGL01583:Slco1c1 APN 6 141540067 missense probably damaging 1.00
IGL01877:Slco1c1 APN 6 141555153 missense probably damaging 0.98
IGL02601:Slco1c1 APN 6 141544829 missense probably damaging 1.00
IGL02852:Slco1c1 APN 6 141547824 nonsense probably null
IGL03058:Slco1c1 APN 6 141563187 missense probably benign 0.44
IGL03102:Slco1c1 APN 6 141544827 missense possibly damaging 0.63
R0101:Slco1c1 UTSW 6 141531510 missense probably damaging 0.99
R0326:Slco1c1 UTSW 6 141559773 missense probably benign 0.45
R0755:Slco1c1 UTSW 6 141531532 missense probably damaging 0.99
R1335:Slco1c1 UTSW 6 141542127 missense probably damaging 1.00
R2011:Slco1c1 UTSW 6 141555107 missense probably benign 0.00
R2084:Slco1c1 UTSW 6 141559852 nonsense probably null
R2163:Slco1c1 UTSW 6 141559752 missense probably benign 0.25
R2190:Slco1c1 UTSW 6 141563167 missense probably benign 0.02
R2248:Slco1c1 UTSW 6 141546689 missense probably damaging 1.00
R2876:Slco1c1 UTSW 6 141559856 missense probably damaging 1.00
R3004:Slco1c1 UTSW 6 141532654 missense probably damaging 1.00
R3196:Slco1c1 UTSW 6 141531448 splice site probably null
R4444:Slco1c1 UTSW 6 141546691 missense possibly damaging 0.96
R4529:Slco1c1 UTSW 6 141555181 missense probably damaging 1.00
R4743:Slco1c1 UTSW 6 141564516 missense probably damaging 0.98
R5261:Slco1c1 UTSW 6 141546776 missense probably damaging 1.00
R5451:Slco1c1 UTSW 6 141559878 missense probably benign 0.04
R5558:Slco1c1 UTSW 6 141567496 missense probably damaging 0.97
R5813:Slco1c1 UTSW 6 141542203 missense probably damaging 1.00
R5836:Slco1c1 UTSW 6 141569314 missense probably damaging 1.00
R6084:Slco1c1 UTSW 6 141546770 missense probably benign 0.02
R6434:Slco1c1 UTSW 6 141547850 missense probably damaging 1.00
R6544:Slco1c1 UTSW 6 141531444 splice site probably null
R6766:Slco1c1 UTSW 6 141547809 missense possibly damaging 0.49
R6865:Slco1c1 UTSW 6 141540052 missense probably damaging 1.00
R7050:Slco1c1 UTSW 6 141547926 missense probably damaging 1.00
R7164:Slco1c1 UTSW 6 141542129 nonsense probably null
R7362:Slco1c1 UTSW 6 141569463 missense probably benign 0.00
R7696:Slco1c1 UTSW 6 141567610 missense probably benign 0.01
R8316:Slco1c1 UTSW 6 141546914 missense probably benign 0.03
R8799:Slco1c1 UTSW 6 141559805 missense probably benign 0.22
R9345:Slco1c1 UTSW 6 141547827 missense probably benign 0.22
X0061:Slco1c1 UTSW 6 141532739 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTTGCAGTAACCAGGAATGAC -3'
(R):5'- CCAGTACTTGGGCTGCAATC -3'

Sequencing Primer
(F):5'- AACTAAGAAGTTGCCTCTGCTGG -3'
(R):5'- TTGGGCTGCAATCCACGATC -3'
Posted On 2019-06-26