Incidental Mutation 'R7255:Bcat1'
ID 564200
Institutional Source Beutler Lab
Gene Symbol Bcat1
Ensembl Gene ENSMUSG00000030268
Gene Name branched chain aminotransferase 1, cytosolic
Synonyms Eca39, Bcat-1, BCATc
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R7255 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 144993835-145076184 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 145032785 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 237 (E237*)
Ref Sequence ENSEMBL: ENSMUSP00000032402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032402] [ENSMUST00000048252] [ENSMUST00000111742] [ENSMUST00000123930] [ENSMUST00000149769] [ENSMUST00000204138]
AlphaFold P24288
Predicted Effect probably null
Transcript: ENSMUST00000032402
AA Change: E237*
SMART Domains Protein: ENSMUSP00000032402
Gene: ENSMUSG00000030268
AA Change: E237*

DomainStartEndE-ValueType
Pfam:Aminotran_4 160 410 1.3e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000048252
AA Change: E170*
SMART Domains Protein: ENSMUSP00000039744
Gene: ENSMUSG00000030268
AA Change: E170*

DomainStartEndE-ValueType
Pfam:Aminotran_4 111 354 5.9e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111742
AA Change: E170*
SMART Domains Protein: ENSMUSP00000107371
Gene: ENSMUSG00000030268
AA Change: E170*

DomainStartEndE-ValueType
Pfam:Aminotran_4 111 354 1.7e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000123930
AA Change: E169*
SMART Domains Protein: ENSMUSP00000120180
Gene: ENSMUSG00000030268
AA Change: E169*

DomainStartEndE-ValueType
PDB:2COJ|B 2 224 1e-139 PDB
SCOP:d1ekfa_ 21 224 1e-76 SMART
Blast:FN3 129 192 5e-7 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000136819
AA Change: E20*
SMART Domains Protein: ENSMUSP00000117708
Gene: ENSMUSG00000030268
AA Change: E20*

DomainStartEndE-ValueType
PDB:2COJ|B 2 76 2e-45 PDB
SCOP:d1ekfa_ 2 76 2e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149769
SMART Domains Protein: ENSMUSP00000116091
Gene: ENSMUSG00000030268

DomainStartEndE-ValueType
PDB:2ABJ|J 2 136 1e-78 PDB
SCOP:d1ekfa_ 2 136 1e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204138
SMART Domains Protein: ENSMUSP00000144968
Gene: ENSMUSG00000030268

DomainStartEndE-ValueType
Pfam:Aminotran_4 34 180 9.1e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of the enzyme branched-chain amino acid transaminase. This enzyme catalyzes the reversible transamination of branched-chain alpha-keto acids to branched-chain L-amino acids essential for cell growth. Two different clinical disorders have been attributed to a defect of branched-chain amino acid transamination: hypervalinemia and hyperleucine-isoleucinemia. As there is also a gene encoding a mitochondrial form of this enzyme, mutations in either gene may contribute to these disorders. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null mutation display abnormal amino acid metabilism in T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G A 11: 23,620,465 P145L probably benign Het
9530003J23Rik T C 10: 117,234,422 H150R probably benign Het
Aldh1a7 A G 19: 20,714,728 S234P probably damaging Het
Arhgap28 T C 17: 67,853,004 H650R probably damaging Het
Asic1 A G 15: 99,697,457 D355G probably damaging Het
Atp8b1 T A 18: 64,556,868 S598C probably damaging Het
Btbd16 A T 7: 130,785,992 I114F probably benign Het
Casp2 A G 6: 42,268,907 D166G probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cpsf1 G A 15: 76,597,543 T1099M probably damaging Het
Crisp4 C A 1: 18,130,231 A116S probably damaging Het
Cyb5r3 A G 15: 83,160,165 I168T probably damaging Het
Dip2b G A 15: 100,209,627 D1407N probably benign Het
Dnajc8 A G 4: 132,551,573 K201R probably benign Het
Dock10 C T 1: 80,543,099 probably null Het
Dopey2 C A 16: 93,770,146 H1272N probably damaging Het
Dsc1 C T 18: 20,097,273 R325Q probably benign Het
Enpp1 A T 10: 24,645,315 I838K possibly damaging Het
Fcna T G 2: 25,626,028 D159A probably damaging Het
Flnc G T 6: 29,445,766 G840C probably damaging Het
Flt1 C T 5: 147,580,406 A1024T probably damaging Het
Galc T C 12: 98,246,255 K207R probably null Het
Gbp2b T A 3: 142,608,117 L386Q probably damaging Het
Gm8297 T A 14: 4,984,874 N48K probably damaging Het
Gm9639 G A 10: 77,794,538 P180L unknown Het
Inpp5a A G 7: 139,511,448 N116S probably damaging Het
Ipo9 T C 1: 135,385,988 E984G probably benign Het
Klra4 A G 6: 130,059,642 F145L probably damaging Het
Lag3 A G 6: 124,910,235 L123P probably benign Het
Med7 T A 11: 46,440,995 M139K probably damaging Het
Mfsd2a A C 4: 122,952,021 L153R possibly damaging Het
Mup9 A G 4: 60,421,337 V71A probably benign Het
Myo16 A T 8: 10,499,169 Q927L unknown Het
Myo9b T C 8: 71,290,891 Y199H probably damaging Het
Nefm A G 14: 68,116,000 F406L probably benign Het
Olfr1123 T A 2: 87,418,942 L296Q probably damaging Het
Olfr1333 A T 4: 118,829,952 F162I probably benign Het
Pamr1 T C 2: 102,611,584 F173L probably damaging Het
Pds5b T A 5: 150,796,667 D1205E probably benign Het
Plxna2 T G 1: 194,752,103 F646V probably benign Het
Pnrc1 C T 4: 33,248,045 G118D probably benign Het
Ppp1r16b T C 2: 158,761,391 F412S probably benign Het
Prcc A T 3: 87,870,091 V192E probably damaging Het
Psg19 A G 7: 18,794,048 Y257H probably benign Het
Rfx7 T G 9: 72,619,828 S1433R possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Sbspon G T 1: 15,883,797 C86* probably null Het
Sdhb A G 4: 140,977,418 E230G possibly damaging Het
Sema6b T C 17: 56,125,336 T581A probably benign Het
Shkbp1 G T 7: 27,342,748 T594K possibly damaging Het
Shpk A G 11: 73,199,660 S48G probably benign Het
Slc1a3 A G 15: 8,642,999 V332A possibly damaging Het
Slc25a25 T C 2: 32,421,372 E135G possibly damaging Het
Slc5a8 A T 10: 88,909,631 D367V probably damaging Het
Slco1c1 A G 6: 141,569,325 T649A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats1 T A 17: 45,454,205 D163V probably damaging Het
Ssh2 T A 11: 77,425,593 M304K probably damaging Het
Sulf1 T A 1: 12,859,008 D166E probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Tcf7l1 A T 6: 72,627,347 probably null Het
Tet1 A T 10: 62,822,636 M1477K probably benign Het
Tlr5 T C 1: 182,974,316 F395S probably damaging Het
Trrap T C 5: 144,858,954 L3847P probably damaging Het
Tsks C T 7: 44,952,688 S276L probably benign Het
Uggt1 T C 1: 36,146,106 E1519G probably damaging Het
Vps13a A G 19: 16,654,339 probably null Het
Wdfy4 A G 14: 32,974,282 V2768A Het
Wdr26 A C 1: 181,181,324 I627R probably benign Het
Zfp160 T A 17: 21,025,487 S100T probably benign Het
Other mutations in Bcat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Bcat1 APN 6 145000289 missense possibly damaging 0.89
IGL01882:Bcat1 APN 6 145004409 missense probably damaging 1.00
IGL02021:Bcat1 APN 6 145047289 splice site probably benign
IGL02024:Bcat1 APN 6 145032838 missense probably damaging 0.97
IGL02705:Bcat1 APN 6 145019188 splice site probably benign
IGL02954:Bcat1 APN 6 145019219 missense probably damaging 1.00
R0331:Bcat1 UTSW 6 145047314 missense probably benign 0.17
R1592:Bcat1 UTSW 6 145010058 missense probably benign 0.00
R1680:Bcat1 UTSW 6 145039628 missense probably damaging 1.00
R2162:Bcat1 UTSW 6 145010108 missense probably damaging 1.00
R2306:Bcat1 UTSW 6 145007653 missense probably damaging 0.96
R3498:Bcat1 UTSW 6 145019342 missense probably damaging 0.99
R3758:Bcat1 UTSW 6 145032872 missense probably damaging 1.00
R3831:Bcat1 UTSW 6 145010108 missense probably damaging 1.00
R3833:Bcat1 UTSW 6 145010108 missense probably damaging 1.00
R4829:Bcat1 UTSW 6 145015475 missense probably damaging 1.00
R5250:Bcat1 UTSW 6 145047439 critical splice donor site probably null
R5338:Bcat1 UTSW 6 145007627 missense possibly damaging 0.50
R5414:Bcat1 UTSW 6 145015447 critical splice donor site probably null
R5679:Bcat1 UTSW 6 145007748 missense probably damaging 1.00
R6566:Bcat1 UTSW 6 145015484 missense probably damaging 1.00
R7015:Bcat1 UTSW 6 145039583 missense probably damaging 0.99
R7606:Bcat1 UTSW 6 145048632 missense probably benign 0.06
R8115:Bcat1 UTSW 6 145010093 missense probably damaging 1.00
R9198:Bcat1 UTSW 6 145039496 missense probably damaging 1.00
R9342:Bcat1 UTSW 6 145048606 missense probably benign
RF004:Bcat1 UTSW 6 145007623 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAATACCCAAGATGCAATTCTGAC -3'
(R):5'- CCAATCGGCACTGCAACATG -3'

Sequencing Primer
(F):5'- TTCTGACATCCACACACGTG -3'
(R):5'- CTCTCTGATCTGGGAGTCTGAC -3'
Posted On 2019-06-26