Incidental Mutation 'R7255:Enpp1'
ID 564210
Institutional Source Beutler Lab
Gene Symbol Enpp1
Ensembl Gene ENSMUSG00000037370
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 1
Synonyms PC-1, E-NPP1, Npps, Pca, Pdnp1, CD203c, twy, NPP1, 4833416E15Rik, Pca-1, Ly-41
MMRRC Submission 045316-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.195) question?
Stock # R7255 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 24513812-24588057 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24521213 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 838 (I838K)
Ref Sequence ENSEMBL: ENSMUSP00000114273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039882] [ENSMUST00000105520] [ENSMUST00000135846]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039882
SMART Domains Protein: ENSMUSP00000046090
Gene: ENSMUSG00000037370

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 59 69 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 358 1e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105520
AA Change: I837K

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101159
Gene: ENSMUSG00000037370
AA Change: I837K

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 1.8e-87 PFAM
Endonuclease_NS 655 873 5.33e-15 SMART
NUC 656 887 3.62e-107 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135846
AA Change: I838K

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114273
Gene: ENSMUSG00000037370
AA Change: I838K

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 4.2e-91 PFAM
Endonuclease_NS 656 874 5.33e-15 SMART
NUC 657 888 3.62e-107 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: This gene encodes a member of the nucleoside pyrophosphatase/phosphodiesterase family of enzymes that catalyzes the hydrolysis of pyrophosphate and phosphodiester bonds in nucleotide triphosphates and oligonucleotides, respectively, to generate nucleoside 5'-monophosphates. The encoded protein is a type II transmembrane glycoprotein that negatively regulates bone mineralization. Mice harboring a nonsense mutation in this gene, termed tiptoe walking (ttw), exhibit ectopic ossification of the spinal ligaments. The encoded protein binds to the insulin receptor, inhibits downstream signaling events and induces insulin resistance and glucose tolerance. This gene is located adjacent to a paralog on chromosome 10. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele develop hyperostosis leading to ossific intervertebral fusion, peripheral joint ankylosis and tendon calcification, and display spontaneous arterial and articular cartilage calcification, and altered adipocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a7 A G 19: 20,692,092 (GRCm39) S234P probably damaging Het
Arhgap28 T C 17: 68,159,999 (GRCm39) H650R probably damaging Het
Asic1 A G 15: 99,595,338 (GRCm39) D355G probably damaging Het
Atp8b1 T A 18: 64,689,939 (GRCm39) S598C probably damaging Het
Bcat1 C A 6: 144,978,511 (GRCm39) E237* probably null Het
Btbd16 A T 7: 130,387,722 (GRCm39) I114F probably benign Het
Casp2 A G 6: 42,245,841 (GRCm39) D166G probably damaging Het
Cd86 CA CAA 16: 36,426,917 (GRCm39) probably null Het
Cpsf1 G A 15: 76,481,743 (GRCm39) T1099M probably damaging Het
Crisp4 C A 1: 18,200,455 (GRCm39) A116S probably damaging Het
Cyb5r3 A G 15: 83,044,366 (GRCm39) I168T probably damaging Het
Dip2b G A 15: 100,107,508 (GRCm39) D1407N probably benign Het
Dnajc8 A G 4: 132,278,884 (GRCm39) K201R probably benign Het
Dock10 C T 1: 80,520,816 (GRCm39) probably null Het
Dop1b C A 16: 93,567,034 (GRCm39) H1272N probably damaging Het
Dsc1 C T 18: 20,230,330 (GRCm39) R325Q probably benign Het
Fcna T G 2: 25,516,040 (GRCm39) D159A probably damaging Het
Flnc G T 6: 29,445,765 (GRCm39) G840C probably damaging Het
Flt1 C T 5: 147,517,216 (GRCm39) A1024T probably damaging Het
Galc T C 12: 98,212,514 (GRCm39) K207R probably null Het
Gbp2b T A 3: 142,313,878 (GRCm39) L386Q probably damaging Het
Gm8297 T A 14: 16,165,868 (GRCm39) N48K probably damaging Het
Gm9639 G A 10: 77,630,372 (GRCm39) P180L unknown Het
Inpp5a A G 7: 139,091,364 (GRCm39) N116S probably damaging Het
Ipo9 T C 1: 135,313,726 (GRCm39) E984G probably benign Het
Klra4 A G 6: 130,036,605 (GRCm39) F145L probably damaging Het
Lag3 A G 6: 124,887,198 (GRCm39) L123P probably benign Het
Lyz3 T C 10: 117,070,327 (GRCm39) H150R probably benign Het
Med7 T A 11: 46,331,822 (GRCm39) M139K probably damaging Het
Mfsd2a A C 4: 122,845,814 (GRCm39) L153R possibly damaging Het
Mup9 A G 4: 60,377,336 (GRCm39) V71A probably benign Het
Myo16 A T 8: 10,549,169 (GRCm39) Q927L unknown Het
Myo9b T C 8: 71,743,535 (GRCm39) Y199H probably damaging Het
Nefm A G 14: 68,353,449 (GRCm39) F406L probably benign Het
Or10ag2 T A 2: 87,249,286 (GRCm39) L296Q probably damaging Het
Or10ak11 A T 4: 118,687,149 (GRCm39) F162I probably benign Het
Pamr1 T C 2: 102,441,929 (GRCm39) F173L probably damaging Het
Pds5b T A 5: 150,720,132 (GRCm39) D1205E probably benign Het
Plxna2 T G 1: 194,434,411 (GRCm39) F646V probably benign Het
Pnrc1 C T 4: 33,248,045 (GRCm39) G118D probably benign Het
Ppp1r16b T C 2: 158,603,311 (GRCm39) F412S probably benign Het
Prcc A T 3: 87,777,398 (GRCm39) V192E probably damaging Het
Psg19 A G 7: 18,527,973 (GRCm39) Y257H probably benign Het
Rfx7 T G 9: 72,527,110 (GRCm39) S1433R possibly damaging Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Sanbr G A 11: 23,570,465 (GRCm39) P145L probably benign Het
Sbspon G T 1: 15,954,021 (GRCm39) C86* probably null Het
Sdhb A G 4: 140,704,729 (GRCm39) E230G possibly damaging Het
Sema6b T C 17: 56,432,336 (GRCm39) T581A probably benign Het
Shkbp1 G T 7: 27,042,173 (GRCm39) T594K possibly damaging Het
Shpk A G 11: 73,090,486 (GRCm39) S48G probably benign Het
Slc1a3 A G 15: 8,672,483 (GRCm39) V332A possibly damaging Het
Slc25a25 T C 2: 32,311,384 (GRCm39) E135G possibly damaging Het
Slc5a8 A T 10: 88,745,493 (GRCm39) D367V probably damaging Het
Slco1c1 A G 6: 141,515,051 (GRCm39) T649A probably benign Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Spats1 T A 17: 45,765,131 (GRCm39) D163V probably damaging Het
Ssh2 T A 11: 77,316,419 (GRCm39) M304K probably damaging Het
Sulf1 T A 1: 12,929,232 (GRCm39) D166E probably benign Het
Syne1 A G 10: 5,283,446 (GRCm39) S1540P probably damaging Het
Tcf7l1 A T 6: 72,604,330 (GRCm39) probably null Het
Tet1 A T 10: 62,658,415 (GRCm39) M1477K probably benign Het
Tlr5 T C 1: 182,801,881 (GRCm39) F395S probably damaging Het
Trrap T C 5: 144,795,764 (GRCm39) L3847P probably damaging Het
Tsks C T 7: 44,602,112 (GRCm39) S276L probably benign Het
Uggt1 T C 1: 36,185,187 (GRCm39) E1519G probably damaging Het
Vps13a A G 19: 16,631,703 (GRCm39) probably null Het
Wdfy4 A G 14: 32,696,239 (GRCm39) V2768A Het
Wdr26 A C 1: 181,008,889 (GRCm39) I627R probably benign Het
Zfp160 T A 17: 21,245,749 (GRCm39) S100T probably benign Het
Other mutations in Enpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Enpp1 APN 10 24,521,325 (GRCm39) missense possibly damaging 0.93
IGL00966:Enpp1 APN 10 24,529,929 (GRCm39) missense probably damaging 1.00
IGL01364:Enpp1 APN 10 24,540,512 (GRCm39) missense probably damaging 1.00
IGL02040:Enpp1 APN 10 24,531,754 (GRCm39) missense probably damaging 1.00
IGL02143:Enpp1 APN 10 24,553,872 (GRCm39) missense probably damaging 1.00
IGL02631:Enpp1 APN 10 24,517,859 (GRCm39) missense probably damaging 1.00
IGL02655:Enpp1 APN 10 24,553,872 (GRCm39) missense probably damaging 1.00
IGL02677:Enpp1 APN 10 24,555,083 (GRCm39) splice site probably benign
IGL02691:Enpp1 APN 10 24,587,790 (GRCm39) missense probably damaging 0.99
IGL02966:Enpp1 APN 10 24,536,172 (GRCm39) missense probably damaging 1.00
IGL03087:Enpp1 APN 10 24,531,779 (GRCm39) splice site probably benign
IGL03330:Enpp1 APN 10 24,540,804 (GRCm39) splice site probably benign
IGL03365:Enpp1 APN 10 24,544,923 (GRCm39) missense probably damaging 1.00
IGL03377:Enpp1 APN 10 24,536,181 (GRCm39) critical splice acceptor site probably null
PIT4651001:Enpp1 UTSW 10 24,529,848 (GRCm39) missense probably benign 0.16
R0011:Enpp1 UTSW 10 24,545,900 (GRCm39) nonsense probably null
R0201:Enpp1 UTSW 10 24,529,815 (GRCm39) missense probably benign 0.00
R0496:Enpp1 UTSW 10 24,547,950 (GRCm39) missense probably benign 0.18
R1228:Enpp1 UTSW 10 24,521,310 (GRCm39) missense probably benign 0.30
R1536:Enpp1 UTSW 10 24,517,732 (GRCm39) missense probably benign 0.27
R1927:Enpp1 UTSW 10 24,530,786 (GRCm39) missense possibly damaging 0.65
R2051:Enpp1 UTSW 10 24,587,702 (GRCm39) critical splice donor site probably null
R2057:Enpp1 UTSW 10 24,536,090 (GRCm39) missense probably damaging 0.98
R2353:Enpp1 UTSW 10 24,527,239 (GRCm39) missense probably benign 0.24
R4077:Enpp1 UTSW 10 24,544,905 (GRCm39) critical splice donor site probably null
R4079:Enpp1 UTSW 10 24,544,905 (GRCm39) critical splice donor site probably null
R4739:Enpp1 UTSW 10 24,555,146 (GRCm39) missense probably null 0.99
R4740:Enpp1 UTSW 10 24,555,146 (GRCm39) missense probably null 0.99
R4761:Enpp1 UTSW 10 24,517,849 (GRCm39) missense possibly damaging 0.94
R4822:Enpp1 UTSW 10 24,537,833 (GRCm39) missense possibly damaging 0.74
R4919:Enpp1 UTSW 10 24,523,983 (GRCm39) missense probably benign 0.01
R5140:Enpp1 UTSW 10 24,528,750 (GRCm39) missense possibly damaging 0.51
R5302:Enpp1 UTSW 10 24,527,288 (GRCm39) missense probably benign
R5421:Enpp1 UTSW 10 24,545,655 (GRCm39) missense probably damaging 1.00
R5695:Enpp1 UTSW 10 24,530,806 (GRCm39) missense probably damaging 0.99
R5735:Enpp1 UTSW 10 24,530,817 (GRCm39) missense possibly damaging 0.92
R5789:Enpp1 UTSW 10 24,523,137 (GRCm39) missense probably benign
R5942:Enpp1 UTSW 10 24,551,966 (GRCm39) nonsense probably null
R6048:Enpp1 UTSW 10 24,536,152 (GRCm39) missense probably damaging 1.00
R6053:Enpp1 UTSW 10 24,533,024 (GRCm39) missense possibly damaging 0.93
R6305:Enpp1 UTSW 10 24,517,780 (GRCm39) missense probably damaging 1.00
R6319:Enpp1 UTSW 10 24,523,929 (GRCm39) missense probably damaging 1.00
R6624:Enpp1 UTSW 10 24,545,653 (GRCm39) nonsense probably null
R6793:Enpp1 UTSW 10 24,531,723 (GRCm39) missense probably damaging 1.00
R6936:Enpp1 UTSW 10 24,527,237 (GRCm39) missense probably benign 0.30
R7285:Enpp1 UTSW 10 24,536,059 (GRCm39) missense probably benign 0.01
R7401:Enpp1 UTSW 10 24,521,180 (GRCm39) missense probably damaging 1.00
R7429:Enpp1 UTSW 10 24,587,848 (GRCm39) missense probably benign 0.00
R7430:Enpp1 UTSW 10 24,587,848 (GRCm39) missense probably benign 0.00
R7526:Enpp1 UTSW 10 24,550,308 (GRCm39) splice site probably null
R7532:Enpp1 UTSW 10 24,551,885 (GRCm39) missense probably benign 0.29
R7789:Enpp1 UTSW 10 24,529,981 (GRCm39) splice site probably null
R8073:Enpp1 UTSW 10 24,555,142 (GRCm39) missense possibly damaging 0.50
R8283:Enpp1 UTSW 10 24,550,554 (GRCm39) missense probably benign 0.25
R8955:Enpp1 UTSW 10 24,544,926 (GRCm39) missense probably benign 0.01
R9494:Enpp1 UTSW 10 24,527,234 (GRCm39) missense probably benign
Z1177:Enpp1 UTSW 10 24,537,840 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGATGTATCAAGACGCACGCG -3'
(R):5'- TCAGTAAAAGTAGGCTGTACTGAAG -3'

Sequencing Primer
(F):5'- AAGGCCCACATGTAAAACCATTAGG -3'
(R):5'- CGAAGCCAGGAAATTCTG -3'
Posted On 2019-06-26