Mutagenetix > Incidental Mutations

Incidental Mutation 'R7255:Slc5a8'

564213

Institutional Source

Beutler Lab

Gene Symbol

Slc5a8

Ensembl Gene

ENSMUSG00000020062

Gene Name

solute carrier family 5 (iodide transporter), member 8

Synonyms

SMCT

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7255 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88885992-88929515 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 88909631 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 367 (D367V)

Ref Sequence

ENSEMBL: ENSMUSP00000020255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020255]

AlphaFold

Q8BYF6

Predicted Effect

probably damaging
Transcript: ENSMUST00000020255
AA Change: D367V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020255
Gene: ENSMUSG00000020062
AA Change: D367V

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
Pfam:SSF	45	449	2.6e-38	PFAM
low complexity region	462	478	N/A	INTRINSIC
transmembrane domain	519	541	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC5A8 has been shown to transport iodide by a passive mechanism (Rodriguez et al., 2002 [PubMed 12107270]) and monocarboxylates and short-chain fatty acids by a sodium-coupled mechanism (Gopal et al., 2004 [PubMed 15322102]). In kidney, SLC5A8 functions as a high-affinity sodium-coupled lactate transporter involved in reabsorption of lactate and maintenance of blood lactate levels (Thangaraju et al., 2006 [PubMed 16873376]).[supplied by OMIM, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased lactate concentrations in the saliva and urine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	G	A	11: 23,620,465	P145L	probably benign	Het
9530003J23Rik	T	C	10: 117,234,422	H150R	probably benign	Het
Aldh1a7	A	G	19: 20,714,728	S234P	probably damaging	Het
Arhgap28	T	C	17: 67,853,004	H650R	probably damaging	Het
Asic1	A	G	15: 99,697,457	D355G	probably damaging	Het
Atp8b1	T	A	18: 64,556,868	S598C	probably damaging	Het
Bcat1	C	A	6: 145,032,785	E237*	probably null	Het
Btbd16	A	T	7: 130,785,992	I114F	probably benign	Het
Casp2	A	G	6: 42,268,907	D166G	probably damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cpsf1	G	A	15: 76,597,543	T1099M	probably damaging	Het
Crisp4	C	A	1: 18,130,231	A116S	probably damaging	Het
Cyb5r3	A	G	15: 83,160,165	I168T	probably damaging	Het
Dip2b	G	A	15: 100,209,627	D1407N	probably benign	Het
Dnajc8	A	G	4: 132,551,573	K201R	probably benign	Het
Dock10	C	T	1: 80,543,099		probably null	Het
Dopey2	C	A	16: 93,770,146	H1272N	probably damaging	Het
Dsc1	C	T	18: 20,097,273	R325Q	probably benign	Het
Enpp1	A	T	10: 24,645,315	I838K	possibly damaging	Het
Fcna	T	G	2: 25,626,028	D159A	probably damaging	Het
Flnc	G	T	6: 29,445,766	G840C	probably damaging	Het
Flt1	C	T	5: 147,580,406	A1024T	probably damaging	Het
Galc	T	C	12: 98,246,255	K207R	probably null	Het
Gbp2b	T	A	3: 142,608,117	L386Q	probably damaging	Het
Gm8297	T	A	14: 4,984,874	N48K	probably damaging	Het
Gm9639	G	A	10: 77,794,538	P180L	unknown	Het
Inpp5a	A	G	7: 139,511,448	N116S	probably damaging	Het
Ipo9	T	C	1: 135,385,988	E984G	probably benign	Het
Klra4	A	G	6: 130,059,642	F145L	probably damaging	Het
Lag3	A	G	6: 124,910,235	L123P	probably benign	Het
Med7	T	A	11: 46,440,995	M139K	probably damaging	Het
Mfsd2a	A	C	4: 122,952,021	L153R	possibly damaging	Het
Mup9	A	G	4: 60,421,337	V71A	probably benign	Het
Myo16	A	T	8: 10,499,169	Q927L	unknown	Het
Myo9b	T	C	8: 71,290,891	Y199H	probably damaging	Het
Nefm	A	G	14: 68,116,000	F406L	probably benign	Het
Olfr1123	T	A	2: 87,418,942	L296Q	probably damaging	Het
Olfr1333	A	T	4: 118,829,952	F162I	probably benign	Het
Pamr1	T	C	2: 102,611,584	F173L	probably damaging	Het
Pds5b	T	A	5: 150,796,667	D1205E	probably benign	Het
Plxna2	T	G	1: 194,752,103	F646V	probably benign	Het
Pnrc1	C	T	4: 33,248,045	G118D	probably benign	Het
Ppp1r16b	T	C	2: 158,761,391	F412S	probably benign	Het
Prcc	A	T	3: 87,870,091	V192E	probably damaging	Het
Psg19	A	G	7: 18,794,048	Y257H	probably benign	Het
Rfx7	T	G	9: 72,619,828	S1433R	possibly damaging	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Sbspon	G	T	1: 15,883,797	C86*	probably null	Het
Sdhb	A	G	4: 140,977,418	E230G	possibly damaging	Het
Sema6b	T	C	17: 56,125,336	T581A	probably benign	Het
Shkbp1	G	T	7: 27,342,748	T594K	possibly damaging	Het
Shpk	A	G	11: 73,199,660	S48G	probably benign	Het
Slc1a3	A	G	15: 8,642,999	V332A	possibly damaging	Het
Slc25a25	T	C	2: 32,421,372	E135G	possibly damaging	Het
Slco1c1	A	G	6: 141,569,325	T649A	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spats1	T	A	17: 45,454,205	D163V	probably damaging	Het
Ssh2	T	A	11: 77,425,593	M304K	probably damaging	Het
Sulf1	T	A	1: 12,859,008	D166E	probably benign	Het
Syne1	A	G	10: 5,333,446	S1540P	probably damaging	Het
Tcf7l1	A	T	6: 72,627,347		probably null	Het
Tet1	A	T	10: 62,822,636	M1477K	probably benign	Het
Tlr5	T	C	1: 182,974,316	F395S	probably damaging	Het
Trrap	T	C	5: 144,858,954	L3847P	probably damaging	Het
Tsks	C	T	7: 44,952,688	S276L	probably benign	Het
Uggt1	T	C	1: 36,146,106	E1519G	probably damaging	Het
Vps13a	A	G	19: 16,654,339		probably null	Het
Wdfy4	A	G	14: 32,974,282	V2768A		Het
Wdr26	A	C	1: 181,181,324	I627R	probably benign	Het
Zfp160	T	A	17: 21,025,487	S100T	probably benign	Het

Other mutations in Slc5a8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00507:Slc5a8	APN	10	88908040	missense	possibly damaging	0.91
IGL00902:Slc5a8	APN	10	88919461	missense	probably benign	0.03
IGL00960:Slc5a8	APN	10	88921765	missense	probably benign	0.21
IGL01109:Slc5a8	APN	10	88906392	missense	possibly damaging	0.95
IGL01365:Slc5a8	APN	10	88892097	splice site	probably benign
IGL01418:Slc5a8	APN	10	88905033	missense	probably damaging	1.00
IGL01823:Slc5a8	APN	10	88919472	nonsense	probably null
IGL02116:Slc5a8	APN	10	88919500	missense	probably benign
IGL03109:Slc5a8	APN	10	88906416	splice site	probably benign
PIT4585001:Slc5a8	UTSW	10	88886503	missense	probably damaging	1.00
R0010:Slc5a8	UTSW	10	88886590	missense	probably benign	0.03
R0418:Slc5a8	UTSW	10	88886558	missense	probably benign	0.01
R1233:Slc5a8	UTSW	10	88918442	missense	probably damaging	1.00
R1656:Slc5a8	UTSW	10	88925786	critical splice donor site	probably null
R1769:Slc5a8	UTSW	10	88919464	missense	probably benign
R1769:Slc5a8	UTSW	10	88919466	nonsense	probably null
R2870:Slc5a8	UTSW	10	88904963	missense	probably benign	0.01
R2870:Slc5a8	UTSW	10	88904963	missense	probably benign	0.01
R2873:Slc5a8	UTSW	10	88904963	missense	probably benign	0.01
R3883:Slc5a8	UTSW	10	88902463	missense	possibly damaging	0.89
R4207:Slc5a8	UTSW	10	88911413	missense	probably damaging	1.00
R4731:Slc5a8	UTSW	10	88925787	critical splice donor site	probably null
R4880:Slc5a8	UTSW	10	88892024	missense	probably damaging	1.00
R4969:Slc5a8	UTSW	10	88904912	splice site	probably null
R4998:Slc5a8	UTSW	10	88908057	critical splice donor site	probably null
R5009:Slc5a8	UTSW	10	88909654	missense	probably benign	0.07
R5068:Slc5a8	UTSW	10	88886598	missense	possibly damaging	0.82
R5069:Slc5a8	UTSW	10	88886598	missense	possibly damaging	0.82
R5070:Slc5a8	UTSW	10	88886598	missense	possibly damaging	0.82
R5130:Slc5a8	UTSW	10	88926215	missense	probably benign
R5141:Slc5a8	UTSW	10	88919560	critical splice donor site	probably null
R5252:Slc5a8	UTSW	10	88906347	missense	probably damaging	1.00
R5659:Slc5a8	UTSW	10	88919428	missense	possibly damaging	0.89
R5660:Slc5a8	UTSW	10	88919428	missense	possibly damaging	0.89
R5661:Slc5a8	UTSW	10	88919428	missense	possibly damaging	0.89
R6039:Slc5a8	UTSW	10	88886574	missense	probably benign	0.00
R6039:Slc5a8	UTSW	10	88886574	missense	probably benign	0.00
R6378:Slc5a8	UTSW	10	88905054	missense	probably damaging	1.00
R7214:Slc5a8	UTSW	10	88919502	missense	probably benign
R7526:Slc5a8	UTSW	10	88902491	missense	probably damaging	1.00
R7604:Slc5a8	UTSW	10	88904960	missense	possibly damaging	0.78
R7688:Slc5a8	UTSW	10	88921699	missense	probably damaging	1.00
R7869:Slc5a8	UTSW	10	88921705	missense	probably benign	0.15
R8219:Slc5a8	UTSW	10	88921699	missense	probably damaging	1.00
R8474:Slc5a8	UTSW	10	88921690	missense	possibly damaging	0.69
R8937:Slc5a8	UTSW	10	88905023	missense	probably damaging	1.00
R8960:Slc5a8	UTSW	10	88886173	start gained	probably benign
R9000:Slc5a8	UTSW	10	88926227	missense	probably benign	0.00
R9000:Slc5a8	UTSW	10	88926228	missense	probably benign	0.13
Z1177:Slc5a8	UTSW	10	88909613	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCAGAAAGAGGGTAGTATGATC -3'
(R):5'- ACATGTGCCTGGATAGGTATTC -3'

Sequencing Primer
(F):5'- GTGTATCACATGCACGTAGC -3'
(R):5'- CCTGGATAGGTATTCATACTAGGAG -3'

Posted On

2019-06-26