Incidental Mutation 'R7255:Med7'
ID 564216
Institutional Source Beutler Lab
Gene Symbol Med7
Ensembl Gene ENSMUSG00000020397
Gene Name mediator complex subunit 7
Synonyms Crsp33, Crsp9, 1110063B05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock # R7255 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 46436925-46442721 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 46440995 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 139 (M139K)
Ref Sequence ENSEMBL: ENSMUSP00000020665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020665] [ENSMUST00000109231] [ENSMUST00000109232] [ENSMUST00000128940] [ENSMUST00000133635] [ENSMUST00000140027] [ENSMUST00000152119] [ENSMUST00000170928]
AlphaFold Q9CZB6
Predicted Effect probably damaging
Transcript: ENSMUST00000020665
AA Change: M139K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020665
Gene: ENSMUSG00000020397
AA Change: M139K

DomainStartEndE-ValueType
Pfam:Med7 6 165 3.9e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109231
AA Change: M139K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104854
Gene: ENSMUSG00000020397
AA Change: M139K

DomainStartEndE-ValueType
Pfam:Med7 6 165 3.6e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109232
AA Change: M139K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104855
Gene: ENSMUSG00000020397
AA Change: M139K

DomainStartEndE-ValueType
Pfam:Med7 6 165 3.9e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128940
AA Change: M139K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116997
Gene: ENSMUSG00000020397
AA Change: M139K

DomainStartEndE-ValueType
Pfam:Med7 6 157 4.1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133635
SMART Domains Protein: ENSMUSP00000120617
Gene: ENSMUSG00000020397

DomainStartEndE-ValueType
Pfam:Med7 6 133 2.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140027
SMART Domains Protein: ENSMUSP00000120077
Gene: ENSMUSG00000020397

DomainStartEndE-ValueType
Pfam:Med7 6 61 8.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152119
SMART Domains Protein: ENSMUSP00000122182
Gene: ENSMUSG00000020397

DomainStartEndE-ValueType
Pfam:Med7 6 93 6.7e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170928
AA Change: M139K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131852
Gene: ENSMUSG00000020397
AA Change: M139K

DomainStartEndE-ValueType
Pfam:Med7 7 164 1.9e-46 PFAM
Meta Mutation Damage Score 0.7051 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G A 11: 23,620,465 P145L probably benign Het
9530003J23Rik T C 10: 117,234,422 H150R probably benign Het
Aldh1a7 A G 19: 20,714,728 S234P probably damaging Het
Arhgap28 T C 17: 67,853,004 H650R probably damaging Het
Asic1 A G 15: 99,697,457 D355G probably damaging Het
Atp8b1 T A 18: 64,556,868 S598C probably damaging Het
Bcat1 C A 6: 145,032,785 E237* probably null Het
Btbd16 A T 7: 130,785,992 I114F probably benign Het
Casp2 A G 6: 42,268,907 D166G probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cpsf1 G A 15: 76,597,543 T1099M probably damaging Het
Crisp4 C A 1: 18,130,231 A116S probably damaging Het
Cyb5r3 A G 15: 83,160,165 I168T probably damaging Het
Dip2b G A 15: 100,209,627 D1407N probably benign Het
Dnajc8 A G 4: 132,551,573 K201R probably benign Het
Dock10 C T 1: 80,543,099 probably null Het
Dopey2 C A 16: 93,770,146 H1272N probably damaging Het
Dsc1 C T 18: 20,097,273 R325Q probably benign Het
Enpp1 A T 10: 24,645,315 I838K possibly damaging Het
Fcna T G 2: 25,626,028 D159A probably damaging Het
Flnc G T 6: 29,445,766 G840C probably damaging Het
Flt1 C T 5: 147,580,406 A1024T probably damaging Het
Galc T C 12: 98,246,255 K207R probably null Het
Gbp2b T A 3: 142,608,117 L386Q probably damaging Het
Gm8297 T A 14: 4,984,874 N48K probably damaging Het
Gm9639 G A 10: 77,794,538 P180L unknown Het
Inpp5a A G 7: 139,511,448 N116S probably damaging Het
Ipo9 T C 1: 135,385,988 E984G probably benign Het
Klra4 A G 6: 130,059,642 F145L probably damaging Het
Lag3 A G 6: 124,910,235 L123P probably benign Het
Mfsd2a A C 4: 122,952,021 L153R possibly damaging Het
Mup9 A G 4: 60,421,337 V71A probably benign Het
Myo16 A T 8: 10,499,169 Q927L unknown Het
Myo9b T C 8: 71,290,891 Y199H probably damaging Het
Nefm A G 14: 68,116,000 F406L probably benign Het
Olfr1123 T A 2: 87,418,942 L296Q probably damaging Het
Olfr1333 A T 4: 118,829,952 F162I probably benign Het
Pamr1 T C 2: 102,611,584 F173L probably damaging Het
Pds5b T A 5: 150,796,667 D1205E probably benign Het
Plxna2 T G 1: 194,752,103 F646V probably benign Het
Pnrc1 C T 4: 33,248,045 G118D probably benign Het
Ppp1r16b T C 2: 158,761,391 F412S probably benign Het
Prcc A T 3: 87,870,091 V192E probably damaging Het
Psg19 A G 7: 18,794,048 Y257H probably benign Het
Rfx7 T G 9: 72,619,828 S1433R possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Sbspon G T 1: 15,883,797 C86* probably null Het
Sdhb A G 4: 140,977,418 E230G possibly damaging Het
Sema6b T C 17: 56,125,336 T581A probably benign Het
Shkbp1 G T 7: 27,342,748 T594K possibly damaging Het
Shpk A G 11: 73,199,660 S48G probably benign Het
Slc1a3 A G 15: 8,642,999 V332A possibly damaging Het
Slc25a25 T C 2: 32,421,372 E135G possibly damaging Het
Slc5a8 A T 10: 88,909,631 D367V probably damaging Het
Slco1c1 A G 6: 141,569,325 T649A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats1 T A 17: 45,454,205 D163V probably damaging Het
Ssh2 T A 11: 77,425,593 M304K probably damaging Het
Sulf1 T A 1: 12,859,008 D166E probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Tcf7l1 A T 6: 72,627,347 probably null Het
Tet1 A T 10: 62,822,636 M1477K probably benign Het
Tlr5 T C 1: 182,974,316 F395S probably damaging Het
Trrap T C 5: 144,858,954 L3847P probably damaging Het
Tsks C T 7: 44,952,688 S276L probably benign Het
Uggt1 T C 1: 36,146,106 E1519G probably damaging Het
Vps13a A G 19: 16,654,339 probably null Het
Wdfy4 A G 14: 32,974,282 V2768A Het
Wdr26 A C 1: 181,181,324 I627R probably benign Het
Zfp160 T A 17: 21,025,487 S100T probably benign Het
Other mutations in Med7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1257:Med7 UTSW 11 46440633 missense probably damaging 0.96
R1259:Med7 UTSW 11 46440633 missense probably damaging 0.96
R1260:Med7 UTSW 11 46440633 missense probably damaging 0.96
R7216:Med7 UTSW 11 46440854 missense probably damaging 1.00
R7683:Med7 UTSW 11 46440860 missense possibly damaging 0.46
R8165:Med7 UTSW 11 46441246 missense probably benign 0.12
R9406:Med7 UTSW 11 46441038 missense not run
Predicted Primers PCR Primer
(F):5'- TGAACGGCTTCATCCTATGC -3'
(R):5'- TGTCCAGGACAATTGCTGTTATC -3'

Sequencing Primer
(F):5'- GAACGGCTTCATCCTATGCAATTTG -3'
(R):5'- CCAGGACAATTGCTGTTATCATCAG -3'
Posted On 2019-06-26