Incidental Mutation 'R7255:Ssh2'
ID 564218
Institutional Source Beutler Lab
Gene Symbol Ssh2
Ensembl Gene ENSMUSG00000037926
Gene Name slingshot protein phosphatase 2
Synonyms SSH-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock # R7255 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 77216287-77460220 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 77425593 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 304 (M304K)
Ref Sequence ENSEMBL: ENSMUSP00000137933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037912] [ENSMUST00000181283]
AlphaFold Q5SW75
Predicted Effect probably damaging
Transcript: ENSMUST00000037912
AA Change: M298K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042625
Gene: ENSMUSG00000037926
AA Change: M298K

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
Pfam:DEK_C 251 302 3.1e-13 PFAM
DSPc 307 445 2.2e-41 SMART
low complexity region 459 469 N/A INTRINSIC
low complexity region 871 882 N/A INTRINSIC
low complexity region 1002 1014 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000181283
AA Change: M304K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137933
Gene: ENSMUSG00000037926
AA Change: M304K

DomainStartEndE-ValueType
Pfam:DEK_C 256 309 1.7e-18 PFAM
DSPc 313 451 2.2e-41 SMART
low complexity region 465 475 N/A INTRINSIC
low complexity region 877 888 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
low complexity region 1376 1391 N/A INTRINSIC
Meta Mutation Damage Score 0.9398 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein tyrosine phosphatase that plays a key role in the regulation of actin filaments. The encoded protein dephosphorylates and activates cofilin, which promotes actin filament depolymerization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G A 11: 23,620,465 P145L probably benign Het
9530003J23Rik T C 10: 117,234,422 H150R probably benign Het
Aldh1a7 A G 19: 20,714,728 S234P probably damaging Het
Arhgap28 T C 17: 67,853,004 H650R probably damaging Het
Asic1 A G 15: 99,697,457 D355G probably damaging Het
Atp8b1 T A 18: 64,556,868 S598C probably damaging Het
Bcat1 C A 6: 145,032,785 E237* probably null Het
Btbd16 A T 7: 130,785,992 I114F probably benign Het
Casp2 A G 6: 42,268,907 D166G probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cpsf1 G A 15: 76,597,543 T1099M probably damaging Het
Crisp4 C A 1: 18,130,231 A116S probably damaging Het
Cyb5r3 A G 15: 83,160,165 I168T probably damaging Het
Dip2b G A 15: 100,209,627 D1407N probably benign Het
Dnajc8 A G 4: 132,551,573 K201R probably benign Het
Dock10 C T 1: 80,543,099 probably null Het
Dopey2 C A 16: 93,770,146 H1272N probably damaging Het
Dsc1 C T 18: 20,097,273 R325Q probably benign Het
Enpp1 A T 10: 24,645,315 I838K possibly damaging Het
Fcna T G 2: 25,626,028 D159A probably damaging Het
Flnc G T 6: 29,445,766 G840C probably damaging Het
Flt1 C T 5: 147,580,406 A1024T probably damaging Het
Galc T C 12: 98,246,255 K207R probably null Het
Gbp2b T A 3: 142,608,117 L386Q probably damaging Het
Gm8297 T A 14: 4,984,874 N48K probably damaging Het
Gm9639 G A 10: 77,794,538 P180L unknown Het
Inpp5a A G 7: 139,511,448 N116S probably damaging Het
Ipo9 T C 1: 135,385,988 E984G probably benign Het
Klra4 A G 6: 130,059,642 F145L probably damaging Het
Lag3 A G 6: 124,910,235 L123P probably benign Het
Med7 T A 11: 46,440,995 M139K probably damaging Het
Mfsd2a A C 4: 122,952,021 L153R possibly damaging Het
Mup9 A G 4: 60,421,337 V71A probably benign Het
Myo16 A T 8: 10,499,169 Q927L unknown Het
Myo9b T C 8: 71,290,891 Y199H probably damaging Het
Nefm A G 14: 68,116,000 F406L probably benign Het
Olfr1123 T A 2: 87,418,942 L296Q probably damaging Het
Olfr1333 A T 4: 118,829,952 F162I probably benign Het
Pamr1 T C 2: 102,611,584 F173L probably damaging Het
Pds5b T A 5: 150,796,667 D1205E probably benign Het
Plxna2 T G 1: 194,752,103 F646V probably benign Het
Pnrc1 C T 4: 33,248,045 G118D probably benign Het
Ppp1r16b T C 2: 158,761,391 F412S probably benign Het
Prcc A T 3: 87,870,091 V192E probably damaging Het
Psg19 A G 7: 18,794,048 Y257H probably benign Het
Rfx7 T G 9: 72,619,828 S1433R possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Sbspon G T 1: 15,883,797 C86* probably null Het
Sdhb A G 4: 140,977,418 E230G possibly damaging Het
Sema6b T C 17: 56,125,336 T581A probably benign Het
Shkbp1 G T 7: 27,342,748 T594K possibly damaging Het
Shpk A G 11: 73,199,660 S48G probably benign Het
Slc1a3 A G 15: 8,642,999 V332A possibly damaging Het
Slc25a25 T C 2: 32,421,372 E135G possibly damaging Het
Slc5a8 A T 10: 88,909,631 D367V probably damaging Het
Slco1c1 A G 6: 141,569,325 T649A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats1 T A 17: 45,454,205 D163V probably damaging Het
Sulf1 T A 1: 12,859,008 D166E probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Tcf7l1 A T 6: 72,627,347 probably null Het
Tet1 A T 10: 62,822,636 M1477K probably benign Het
Tlr5 T C 1: 182,974,316 F395S probably damaging Het
Trrap T C 5: 144,858,954 L3847P probably damaging Het
Tsks C T 7: 44,952,688 S276L probably benign Het
Uggt1 T C 1: 36,146,106 E1519G probably damaging Het
Vps13a A G 19: 16,654,339 probably null Het
Wdfy4 A G 14: 32,974,282 V2768A Het
Wdr26 A C 1: 181,181,324 I627R probably benign Het
Zfp160 T A 17: 21,025,487 S100T probably benign Het
Other mutations in Ssh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Ssh2 APN 11 77441926 missense probably damaging 1.00
IGL01141:Ssh2 APN 11 77449726 missense probably damaging 1.00
IGL01520:Ssh2 APN 11 77449906 missense probably damaging 1.00
IGL01803:Ssh2 APN 11 77425330 missense probably damaging 0.99
IGL01989:Ssh2 APN 11 77453685 missense possibly damaging 0.79
IGL02322:Ssh2 APN 11 77416413 critical splice acceptor site probably null
IGL02466:Ssh2 APN 11 77416407 splice site probably benign
IGL02683:Ssh2 APN 11 77398256 missense probably damaging 0.99
IGL02706:Ssh2 APN 11 77453406 missense possibly damaging 0.68
IGL02719:Ssh2 APN 11 77425587 missense probably damaging 1.00
IGL02721:Ssh2 APN 11 77454725 nonsense probably null
IGL02732:Ssh2 APN 11 77437776 splice site probably null
IGL02745:Ssh2 APN 11 77455407 missense probably damaging 1.00
IGL02993:Ssh2 APN 11 77453544 missense probably damaging 1.00
IGL03000:Ssh2 APN 11 77421206 splice site probably benign
david UTSW 11 77425593 missense probably damaging 1.00
faba UTSW 11 77441985 missense probably damaging 1.00
goliath UTSW 11 77453523 missense possibly damaging 0.48
Vicia UTSW 11 77454966 missense possibly damaging 0.68
IGL03055:Ssh2 UTSW 11 77408195 nonsense probably null
R0024:Ssh2 UTSW 11 77454966 missense possibly damaging 0.68
R0374:Ssh2 UTSW 11 77408143 missense probably damaging 1.00
R0539:Ssh2 UTSW 11 77454794 missense probably benign 0.11
R0834:Ssh2 UTSW 11 77437633 missense possibly damaging 0.87
R1714:Ssh2 UTSW 11 77454024 missense possibly damaging 0.94
R1743:Ssh2 UTSW 11 77437756 missense probably damaging 1.00
R1889:Ssh2 UTSW 11 77449745 missense probably damaging 1.00
R1895:Ssh2 UTSW 11 77449745 missense probably damaging 1.00
R3945:Ssh2 UTSW 11 77454668 missense possibly damaging 0.93
R3947:Ssh2 UTSW 11 77398256 missense probably damaging 0.99
R3948:Ssh2 UTSW 11 77398256 missense probably damaging 0.99
R4133:Ssh2 UTSW 11 77421269 missense probably damaging 1.00
R4256:Ssh2 UTSW 11 77408183 missense possibly damaging 0.48
R4499:Ssh2 UTSW 11 77393067 nonsense probably null
R4548:Ssh2 UTSW 11 77450184 missense probably benign 0.20
R4644:Ssh2 UTSW 11 77449576 missense possibly damaging 0.46
R4690:Ssh2 UTSW 11 77455205 missense possibly damaging 0.62
R4788:Ssh2 UTSW 11 77429798 missense probably damaging 1.00
R4919:Ssh2 UTSW 11 77425320 missense possibly damaging 0.91
R5014:Ssh2 UTSW 11 77455276 nonsense probably null
R5380:Ssh2 UTSW 11 77453945 missense probably benign 0.01
R5574:Ssh2 UTSW 11 77450115 missense probably benign
R5593:Ssh2 UTSW 11 77421366 missense probably damaging 0.99
R5739:Ssh2 UTSW 11 77449813 missense probably damaging 1.00
R6180:Ssh2 UTSW 11 77453465 missense probably benign 0.43
R6542:Ssh2 UTSW 11 77450150 missense possibly damaging 0.94
R6713:Ssh2 UTSW 11 77449433 missense possibly damaging 0.89
R7108:Ssh2 UTSW 11 77454794 missense probably benign
R7124:Ssh2 UTSW 11 77454338 missense probably benign 0.00
R7332:Ssh2 UTSW 11 77453523 missense possibly damaging 0.48
R7362:Ssh2 UTSW 11 77449650 missense probably benign 0.01
R7395:Ssh2 UTSW 11 77393073 missense probably damaging 0.99
R7412:Ssh2 UTSW 11 77450108 missense probably damaging 0.98
R7493:Ssh2 UTSW 11 77437716 missense probably benign 0.16
R7686:Ssh2 UTSW 11 77425324 missense possibly damaging 0.89
R7870:Ssh2 UTSW 11 77453615 missense probably benign
R7895:Ssh2 UTSW 11 77454626 missense probably benign 0.41
R7963:Ssh2 UTSW 11 77421356 missense possibly damaging 0.93
R8030:Ssh2 UTSW 11 77454506 missense probably benign 0.01
R8065:Ssh2 UTSW 11 77441985 missense probably damaging 1.00
R8099:Ssh2 UTSW 11 77454929 nonsense probably null
R8294:Ssh2 UTSW 11 77454201 missense probably benign 0.08
R8464:Ssh2 UTSW 11 77454253 nonsense probably null
R8469:Ssh2 UTSW 11 77449608 missense probably benign 0.41
R8547:Ssh2 UTSW 11 77449707 missense probably benign 0.10
R8677:Ssh2 UTSW 11 77455193 missense possibly damaging 0.77
R8758:Ssh2 UTSW 11 77454017 missense probably benign
R9029:Ssh2 UTSW 11 77437628 missense probably damaging 1.00
R9030:Ssh2 UTSW 11 77421236 missense possibly damaging 0.63
R9126:Ssh2 UTSW 11 77455276 nonsense probably null
R9146:Ssh2 UTSW 11 77437676 missense probably damaging 0.98
R9377:Ssh2 UTSW 11 77408148 missense possibly damaging 0.95
RF018:Ssh2 UTSW 11 77454054 missense probably damaging 0.99
X0017:Ssh2 UTSW 11 77441898 missense probably damaging 1.00
Z1088:Ssh2 UTSW 11 77449495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCCAAAGCCAGAAGTGGG -3'
(R):5'- CTTGAGTACACAGAGCCTATGC -3'

Sequencing Primer
(F):5'- TTCCAAAGCCAGAAGTGGGATAAC -3'
(R):5'- GATCTCCTGTGTACCAGATGAATGC -3'
Posted On 2019-06-26