Incidental Mutation 'R0581:Ccer2'
ID56422
Institutional Source Beutler Lab
Gene Symbol Ccer2
Ensembl Gene ENSMUSG00000096257
Gene Namecoiled-coil glutamate-rich protein 2
SynonymsGm6537
MMRRC Submission 038771-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0581 (G1)
Quality Score206
Status Validated
Chromosome7
Chromosomal Location28756174-28758968 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 28757026 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032815] [ENSMUST00000085851] [ENSMUST00000094632] [ENSMUST00000137121] [ENSMUST00000178767]
Predicted Effect probably benign
Transcript: ENSMUST00000032815
SMART Domains Protein: ENSMUSP00000032815
Gene: ENSMUSG00000030595

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
ANK 57 86 4.13e-2 SMART
ANK 93 122 1.6e1 SMART
ANK 126 155 5.98e1 SMART
low complexity region 183 191 N/A INTRINSIC
ANK 206 235 5.12e-7 SMART
ANK 240 269 1.76e-5 SMART
ANK 273 303 1.37e2 SMART
low complexity region 305 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085851
SMART Domains Protein: ENSMUSP00000083012
Gene: ENSMUSG00000030595

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
ANK 57 86 4.13e-2 SMART
ANK 93 122 1.6e1 SMART
ANK 126 155 5.98e1 SMART
low complexity region 183 191 N/A INTRINSIC
ANK 206 235 5.12e-7 SMART
ANK 240 269 1.76e-5 SMART
ANK 273 303 1.37e2 SMART
low complexity region 305 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094632
SMART Domains Protein: ENSMUSP00000092216
Gene: ENSMUSG00000070699

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 58 174 3.8e-8 PFAM
Pfam:tRNA-synt_2b 284 468 5.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137121
SMART Domains Protein: ENSMUSP00000117769
Gene: ENSMUSG00000030595

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
ANK 57 86 4.13e-2 SMART
ANK 93 122 1.6e1 SMART
ANK 126 151 2.15e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178767
SMART Domains Protein: ENSMUSP00000137487
Gene: ENSMUSG00000096257

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 105 117 N/A INTRINSIC
coiled coil region 129 151 N/A INTRINSIC
low complexity region 206 215 N/A INTRINSIC
coiled coil region 228 270 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.3%
  • 20x: 93.7%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 4,050,620 T2761A probably benign Het
Apold1 G A 6: 134,983,813 V77I probably benign Het
Atad2 T C 15: 58,126,664 T139A probably benign Het
Cacna1a A T 8: 84,601,936 I1668F possibly damaging Het
Cyp2c54 T A 19: 40,047,555 T304S probably benign Het
Dpp4 T A 2: 62,356,676 M497L probably benign Het
Evpl T A 11: 116,229,490 I541L probably benign Het
Ggn A G 7: 29,172,304 T370A probably benign Het
Ghr A G 15: 3,388,634 probably benign Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Gpr68 G C 12: 100,878,556 P243R probably damaging Het
Gtf3c2 G T 5: 31,159,518 Y720* probably null Het
Il2rb T A 15: 78,481,936 Y387F possibly damaging Het
Kcnu1 T A 8: 25,937,501 V282E probably damaging Het
Krt222 G A 11: 99,236,192 Q201* probably null Het
Lats1 A G 10: 7,702,941 T610A possibly damaging Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Myh7 T C 14: 54,985,496 I751V probably benign Het
Mypn A G 10: 63,162,244 I429T probably benign Het
Nemf A T 12: 69,322,271 D723E probably benign Het
Nlrp4b T C 7: 10,714,530 L220P probably damaging Het
Npr3 T A 15: 11,851,450 D418V probably damaging Het
Nsd3 A G 8: 25,710,691 N1270S probably damaging Het
Olfr123 A G 17: 37,796,102 I219M probably damaging Het
Olfr344 T C 2: 36,568,822 S75P probably damaging Het
Otogl G A 10: 107,789,040 T1579I possibly damaging Het
Pkp2 T A 16: 16,269,783 probably benign Het
Psd3 T C 8: 67,720,946 Y301C probably damaging Het
Psmb4 T C 3: 94,886,168 H134R probably damaging Het
Ralgapb A G 2: 158,492,961 T1043A probably benign Het
Sec14l5 T A 16: 5,178,485 probably null Het
Serpina12 T A 12: 104,031,140 Q374L probably damaging Het
Serpinb10 C T 1: 107,546,962 R362* probably null Het
Sorcs1 T A 19: 50,252,701 I416F possibly damaging Het
Sparcl1 T C 5: 104,093,312 D82G probably damaging Het
Stat6 A T 10: 127,648,116 Q89L probably damaging Het
Tat A G 8: 109,991,638 T52A possibly damaging Het
Yipf7 T A 5: 69,521,063 I128F probably benign Het
Zfp112 T A 7: 24,125,863 C419S probably damaging Het
Zzef1 A G 11: 72,851,900 I769V probably benign Het
Other mutations in Ccer2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1535:Ccer2 UTSW 7 28757397 nonsense probably null
R1987:Ccer2 UTSW 7 28757283 missense possibly damaging 0.83
R4664:Ccer2 UTSW 7 28756503 missense probably benign 0.36
R5690:Ccer2 UTSW 7 28756204 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAAGAACCTGGTTCCCTTGAAGCTC -3'
(R):5'- TGGATGTTGCTTCCACACATGCTC -3'

Sequencing Primer
(F):5'- CCCTTGAAGCTCGCTGC -3'
(R):5'- tcttctcctcttcttccttttcc -3'
Posted On2013-07-11