Mutagenetix > Incidental Mutation

Incidental Mutation 'R7255:Cpsf1'

564224

Institutional Source

Beutler Lab

Gene Symbol

Cpsf1

Ensembl Gene

ENSMUSG00000034022

Gene Name

cleavage and polyadenylation specific factor 1

Synonyms

MMRRC Submission

045316-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.972) question?

Stock #

R7255 (G1)

Quality Score

195.009

Status

Validated

Chromosome

Chromosomal Location

76595803-76607591 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 76597543 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 1099 (T1099M)

Ref Sequence

ENSEMBL: ENSMUSP00000071794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071898] [ENSMUST00000160784] [ENSMUST00000161612] [ENSMUST00000161732] [ENSMUST00000162503] [ENSMUST00000230157] [ENSMUST00000231042]

AlphaFold

Q9EPU4

Predicted Effect

probably damaging
Transcript: ENSMUST00000071898
AA Change: T1099M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071794
Gene: ENSMUSG00000034022
AA Change: T1099M

Domain	Start	End	E-Value	Type
Pfam:MMS1_N	92	684	7.2e-42	PFAM
low complexity region	902	910	N/A	INTRINSIC
Pfam:CPSF_A	1071	1407	4.9e-94	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000160784

SMART Domains

Protein: ENSMUSP00000124666
Gene: ENSMUSG00000022550

Domain	Start	End	E-Value	Type
transmembrane domain	50	69	N/A	INTRINSIC
Pfam:ABC1	188	304	9.2e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000161612

SMART Domains

Protein: ENSMUSP00000124701
Gene: ENSMUSG00000022550

Domain	Start	End	E-Value	Type
transmembrane domain	50	69	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161732

SMART Domains

Protein: ENSMUSP00000125482
Gene: ENSMUSG00000022550

Domain	Start	End	E-Value	Type
transmembrane domain	50	69	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162503

SMART Domains

Protein: ENSMUSP00000125055
Gene: ENSMUSG00000022550

Domain	Start	End	E-Value	Type
transmembrane domain	50	69	N/A	INTRINSIC
Pfam:ABC1	188	304	2.3e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000229287

Predicted Effect

probably damaging
Transcript: ENSMUST00000230157
AA Change: T1099M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000231042

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cleavage and polyadenylation specificity factor (CPSF) is a multisubunit complex that plays a central role in 3-prime processing of pre-mRNAs. CPSF recognizes the AAUAAA signal in the pre-mRNA and interacts with other proteins to facilitate both RNA cleavage and poly(A) synthesis. CPSF1 is the largest subunit of the CPSF complex (Murthy and Manley, 1995 [PubMed 7590244]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	G	A	11: 23,620,465	P145L	probably benign	Het
9530003J23Rik	T	C	10: 117,234,422	H150R	probably benign	Het
Aldh1a7	A	G	19: 20,714,728	S234P	probably damaging	Het
Arhgap28	T	C	17: 67,853,004	H650R	probably damaging	Het
Asic1	A	G	15: 99,697,457	D355G	probably damaging	Het
Atp8b1	T	A	18: 64,556,868	S598C	probably damaging	Het
Bcat1	C	A	6: 145,032,785	E237*	probably null	Het
Btbd16	A	T	7: 130,785,992	I114F	probably benign	Het
Casp2	A	G	6: 42,268,907	D166G	probably damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Crisp4	C	A	1: 18,130,231	A116S	probably damaging	Het
Cyb5r3	A	G	15: 83,160,165	I168T	probably damaging	Het
Dip2b	G	A	15: 100,209,627	D1407N	probably benign	Het
Dnajc8	A	G	4: 132,551,573	K201R	probably benign	Het
Dock10	C	T	1: 80,543,099		probably null	Het
Dopey2	C	A	16: 93,770,146	H1272N	probably damaging	Het
Dsc1	C	T	18: 20,097,273	R325Q	probably benign	Het
Enpp1	A	T	10: 24,645,315	I838K	possibly damaging	Het
Fcna	T	G	2: 25,626,028	D159A	probably damaging	Het
Flnc	G	T	6: 29,445,766	G840C	probably damaging	Het
Flt1	C	T	5: 147,580,406	A1024T	probably damaging	Het
Galc	T	C	12: 98,246,255	K207R	probably null	Het
Gbp2b	T	A	3: 142,608,117	L386Q	probably damaging	Het
Gm8297	T	A	14: 4,984,874	N48K	probably damaging	Het
Gm9639	G	A	10: 77,794,538	P180L	unknown	Het
Inpp5a	A	G	7: 139,511,448	N116S	probably damaging	Het
Ipo9	T	C	1: 135,385,988	E984G	probably benign	Het
Klra4	A	G	6: 130,059,642	F145L	probably damaging	Het
Lag3	A	G	6: 124,910,235	L123P	probably benign	Het
Med7	T	A	11: 46,440,995	M139K	probably damaging	Het
Mfsd2a	A	C	4: 122,952,021	L153R	possibly damaging	Het
Mup9	A	G	4: 60,421,337	V71A	probably benign	Het
Myo16	A	T	8: 10,499,169	Q927L	unknown	Het
Myo9b	T	C	8: 71,290,891	Y199H	probably damaging	Het
Nefm	A	G	14: 68,116,000	F406L	probably benign	Het
Olfr1123	T	A	2: 87,418,942	L296Q	probably damaging	Het
Olfr1333	A	T	4: 118,829,952	F162I	probably benign	Het
Pamr1	T	C	2: 102,611,584	F173L	probably damaging	Het
Pds5b	T	A	5: 150,796,667	D1205E	probably benign	Het
Plxna2	T	G	1: 194,752,103	F646V	probably benign	Het
Pnrc1	C	T	4: 33,248,045	G118D	probably benign	Het
Ppp1r16b	T	C	2: 158,761,391	F412S	probably benign	Het
Prcc	A	T	3: 87,870,091	V192E	probably damaging	Het
Psg19	A	G	7: 18,794,048	Y257H	probably benign	Het
Rfx7	T	G	9: 72,619,828	S1433R	possibly damaging	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Sbspon	G	T	1: 15,883,797	C86*	probably null	Het
Sdhb	A	G	4: 140,977,418	E230G	possibly damaging	Het
Sema6b	T	C	17: 56,125,336	T581A	probably benign	Het
Shkbp1	G	T	7: 27,342,748	T594K	possibly damaging	Het
Shpk	A	G	11: 73,199,660	S48G	probably benign	Het
Slc1a3	A	G	15: 8,642,999	V332A	possibly damaging	Het
Slc25a25	T	C	2: 32,421,372	E135G	possibly damaging	Het
Slc5a8	A	T	10: 88,909,631	D367V	probably damaging	Het
Slco1c1	A	G	6: 141,569,325	T649A	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spats1	T	A	17: 45,454,205	D163V	probably damaging	Het
Ssh2	T	A	11: 77,425,593	M304K	probably damaging	Het
Sulf1	T	A	1: 12,859,008	D166E	probably benign	Het
Syne1	A	G	10: 5,333,446	S1540P	probably damaging	Het
Tcf7l1	A	T	6: 72,627,347		probably null	Het
Tet1	A	T	10: 62,822,636	M1477K	probably benign	Het
Tlr5	T	C	1: 182,974,316	F395S	probably damaging	Het
Trrap	T	C	5: 144,858,954	L3847P	probably damaging	Het
Tsks	C	T	7: 44,952,688	S276L	probably benign	Het
Uggt1	T	C	1: 36,146,106	E1519G	probably damaging	Het
Vps13a	A	G	19: 16,654,339		probably null	Het
Wdfy4	A	G	14: 32,974,282	V2768A		Het
Wdr26	A	C	1: 181,181,324	I627R	probably benign	Het
Zfp160	T	A	17: 21,025,487	S100T	probably benign	Het

Other mutations in Cpsf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Cpsf1	APN	15	76600216	missense	probably benign	0.27
IGL01013:Cpsf1	APN	15	76599297	nonsense	probably null
IGL01599:Cpsf1	APN	15	76596541	missense	probably damaging	1.00
IGL02008:Cpsf1	APN	15	76603091	missense	probably damaging	1.00
IGL02291:Cpsf1	APN	15	76602821	missense	probably damaging	1.00
IGL02901:Cpsf1	APN	15	76599496	nonsense	probably null
IGL02929:Cpsf1	APN	15	76602127	critical splice donor site	probably null
IGL03402:Cpsf1	APN	15	76596003	splice site	probably null
R0005:Cpsf1	UTSW	15	76600680	critical splice donor site	probably null
R0044:Cpsf1	UTSW	15	76599553	missense	probably benign
R0044:Cpsf1	UTSW	15	76599553	missense	probably benign
R0487:Cpsf1	UTSW	15	76597002	missense	probably damaging	1.00
R0510:Cpsf1	UTSW	15	76603657	intron	probably benign
R0630:Cpsf1	UTSW	15	76601971	missense	probably damaging	1.00
R0780:Cpsf1	UTSW	15	76600377	missense	probably benign	0.17
R1617:Cpsf1	UTSW	15	76602370	nonsense	probably null
R1717:Cpsf1	UTSW	15	76602566	missense	possibly damaging	0.77
R1889:Cpsf1	UTSW	15	76602156	missense	probably benign	0.06
R1994:Cpsf1	UTSW	15	76603160	missense	probably benign	0.03
R2168:Cpsf1	UTSW	15	76603737	missense	possibly damaging	0.69
R2359:Cpsf1	UTSW	15	76597673	missense	probably benign	0.02
R2697:Cpsf1	UTSW	15	76599329	missense	probably damaging	1.00
R2847:Cpsf1	UTSW	15	76602851	missense	probably damaging	1.00
R2848:Cpsf1	UTSW	15	76602851	missense	probably damaging	1.00
R3409:Cpsf1	UTSW	15	76601781	nonsense	probably null
R3410:Cpsf1	UTSW	15	76601781	nonsense	probably null
R3815:Cpsf1	UTSW	15	76601149	missense	probably benign	0.22
R4030:Cpsf1	UTSW	15	76601779	missense	possibly damaging	0.96
R4491:Cpsf1	UTSW	15	76597722	missense	possibly damaging	0.85
R4615:Cpsf1	UTSW	15	76596937	missense	possibly damaging	0.88
R5227:Cpsf1	UTSW	15	76598948	missense	probably damaging	1.00
R5353:Cpsf1	UTSW	15	76602571	missense	probably damaging	1.00
R5548:Cpsf1	UTSW	15	76597327	missense	possibly damaging	0.95
R5552:Cpsf1	UTSW	15	76599646	missense	probably benign	0.27
R5746:Cpsf1	UTSW	15	76599837	missense	probably benign	0.01
R6319:Cpsf1	UTSW	15	76596967	missense	probably damaging	1.00
R6360:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6572:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6574:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6576:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6577:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6588:Cpsf1	UTSW	15	76596822	missense	probably damaging	1.00
R6595:Cpsf1	UTSW	15	76602510	missense	probably damaging	1.00
R6621:Cpsf1	UTSW	15	76603519	missense	probably damaging	1.00
R6880:Cpsf1	UTSW	15	76602539	missense	probably benign	0.06
R6954:Cpsf1	UTSW	15	76599496	missense	probably damaging	1.00
R7100:Cpsf1	UTSW	15	76596114	missense	possibly damaging	0.73
R7318:Cpsf1	UTSW	15	76597275	nonsense	probably null
R7371:Cpsf1	UTSW	15	76600575	missense	probably damaging	1.00
R7387:Cpsf1	UTSW	15	76602566	missense	possibly damaging	0.77
R7446:Cpsf1	UTSW	15	76601750	missense	probably benign
R7612:Cpsf1	UTSW	15	76597009	missense	probably benign	0.00
R7739:Cpsf1	UTSW	15	76600311	missense	probably benign	0.00
R7878:Cpsf1	UTSW	15	76600500	missense	probably damaging	1.00
R8334:Cpsf1	UTSW	15	76603587	missense	probably benign	0.26
R8345:Cpsf1	UTSW	15	76601490	missense	probably benign
R8382:Cpsf1	UTSW	15	76600951	missense	probably benign
R8403:Cpsf1	UTSW	15	76600283	missense	probably damaging	0.96
R8968:Cpsf1	UTSW	15	76601969	nonsense	probably null
R8972:Cpsf1	UTSW	15	76597328	missense	probably damaging	1.00
R9257:Cpsf1	UTSW	15	76600792	missense	probably benign
R9627:Cpsf1	UTSW	15	76599888	missense	probably damaging	0.97
R9776:Cpsf1	UTSW	15	76602579	missense	probably damaging	1.00
X0052:Cpsf1	UTSW	15	76596302	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TCCATGATCAGGATCTGGAAGG -3'
(R):5'- TGCAGACGACAGATACATCC -3'

Sequencing Primer
(F):5'- ACGTATGGAGATGGCCCACTC -3'
(R):5'- GACGACAGATACATCCACCCC -3'

Posted On

2019-06-26