Mutagenetix > Incidental Mutations

Incidental Mutation 'R7255:Cd86'

564228

Institutional Source

Beutler Lab

Gene Symbol

Cd86

Ensembl Gene

ENSMUSG00000022901

Gene Name

CD86 antigen

Synonyms

B70, B7.2, Ly58, Cd28l2, Ly-58, MB7-2, B7-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R7255 (G1)

Quality Score

217.468

Status

Validated

Chromosome

Chromosomal Location

36603869-36666081 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

CA to CAA at 36606555 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000087047 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089620]

AlphaFold

P42082

Predicted Effect

probably null
Transcript: ENSMUST00000089620

SMART Domains

Protein: ENSMUSP00000087047
Gene: ENSMUSG00000022901

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IGv	35	112	1.76e-8	SMART
low complexity region	194	205	N/A	INTRINSIC
transmembrane domain	246	263	N/A	INTRINSIC

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I membrane protein that is a member of the immunoglobulin superfamily. This protein is expressed by antigen-presenting cells, and it is the ligand for two proteins at the cell surface of T cells, CD28 antigen and cytotoxic T-lymphocyte-associated protein 4. Binding of this protein with CD28 antigen is a costimulatory signal for activation of the T-cell. Binding of this protein with cytotoxic T-lymphocyte-associated protein 4 negatively regulates T-cell activation and diminishes the immune response. Alternative splicing results in several transcript variants encoding different isoforms.[provided by RefSeq, May 2011]
PHENOTYPE: Homozygous null mice on an NOD background display a phenotype similar to human Guillain-Barre Syndrome, exhibiting severe peripheral nervous system inflammation, sciatic nerve demyelination, elevated auto-antibodies to myelin protein zero, hindlimb paralysis, and weak forelimb grip. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	G	A	11: 23,620,465	P145L	probably benign	Het
9530003J23Rik	T	C	10: 117,234,422	H150R	probably benign	Het
Aldh1a7	A	G	19: 20,714,728	S234P	probably damaging	Het
Arhgap28	T	C	17: 67,853,004	H650R	probably damaging	Het
Asic1	A	G	15: 99,697,457	D355G	probably damaging	Het
Atp8b1	T	A	18: 64,556,868	S598C	probably damaging	Het
Bcat1	C	A	6: 145,032,785	E237*	probably null	Het
Btbd16	A	T	7: 130,785,992	I114F	probably benign	Het
Casp2	A	G	6: 42,268,907	D166G	probably damaging	Het
Cpsf1	G	A	15: 76,597,543	T1099M	probably damaging	Het
Crisp4	C	A	1: 18,130,231	A116S	probably damaging	Het
Cyb5r3	A	G	15: 83,160,165	I168T	probably damaging	Het
Dip2b	G	A	15: 100,209,627	D1407N	probably benign	Het
Dnajc8	A	G	4: 132,551,573	K201R	probably benign	Het
Dock10	C	T	1: 80,543,099		probably null	Het
Dopey2	C	A	16: 93,770,146	H1272N	probably damaging	Het
Dsc1	C	T	18: 20,097,273	R325Q	probably benign	Het
Enpp1	A	T	10: 24,645,315	I838K	possibly damaging	Het
Fcna	T	G	2: 25,626,028	D159A	probably damaging	Het
Flnc	G	T	6: 29,445,766	G840C	probably damaging	Het
Flt1	C	T	5: 147,580,406	A1024T	probably damaging	Het
Galc	T	C	12: 98,246,255	K207R	probably null	Het
Gbp2b	T	A	3: 142,608,117	L386Q	probably damaging	Het
Gm8297	T	A	14: 4,984,874	N48K	probably damaging	Het
Gm9639	G	A	10: 77,794,538	P180L	unknown	Het
Inpp5a	A	G	7: 139,511,448	N116S	probably damaging	Het
Ipo9	T	C	1: 135,385,988	E984G	probably benign	Het
Klra4	A	G	6: 130,059,642	F145L	probably damaging	Het
Lag3	A	G	6: 124,910,235	L123P	probably benign	Het
Med7	T	A	11: 46,440,995	M139K	probably damaging	Het
Mfsd2a	A	C	4: 122,952,021	L153R	possibly damaging	Het
Mup9	A	G	4: 60,421,337	V71A	probably benign	Het
Myo16	A	T	8: 10,499,169	Q927L	unknown	Het
Myo9b	T	C	8: 71,290,891	Y199H	probably damaging	Het
Nefm	A	G	14: 68,116,000	F406L	probably benign	Het
Olfr1123	T	A	2: 87,418,942	L296Q	probably damaging	Het
Olfr1333	A	T	4: 118,829,952	F162I	probably benign	Het
Pamr1	T	C	2: 102,611,584	F173L	probably damaging	Het
Pds5b	T	A	5: 150,796,667	D1205E	probably benign	Het
Plxna2	T	G	1: 194,752,103	F646V	probably benign	Het
Pnrc1	C	T	4: 33,248,045	G118D	probably benign	Het
Ppp1r16b	T	C	2: 158,761,391	F412S	probably benign	Het
Prcc	A	T	3: 87,870,091	V192E	probably damaging	Het
Psg19	A	G	7: 18,794,048	Y257H	probably benign	Het
Rfx7	T	G	9: 72,619,828	S1433R	possibly damaging	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Sbspon	G	T	1: 15,883,797	C86*	probably null	Het
Sdhb	A	G	4: 140,977,418	E230G	possibly damaging	Het
Sema6b	T	C	17: 56,125,336	T581A	probably benign	Het
Shkbp1	G	T	7: 27,342,748	T594K	possibly damaging	Het
Shpk	A	G	11: 73,199,660	S48G	probably benign	Het
Slc1a3	A	G	15: 8,642,999	V332A	possibly damaging	Het
Slc25a25	T	C	2: 32,421,372	E135G	possibly damaging	Het
Slc5a8	A	T	10: 88,909,631	D367V	probably damaging	Het
Slco1c1	A	G	6: 141,569,325	T649A	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spats1	T	A	17: 45,454,205	D163V	probably damaging	Het
Ssh2	T	A	11: 77,425,593	M304K	probably damaging	Het
Sulf1	T	A	1: 12,859,008	D166E	probably benign	Het
Syne1	A	G	10: 5,333,446	S1540P	probably damaging	Het
Tcf7l1	A	T	6: 72,627,347		probably null	Het
Tet1	A	T	10: 62,822,636	M1477K	probably benign	Het
Tlr5	T	C	1: 182,974,316	F395S	probably damaging	Het
Trrap	T	C	5: 144,858,954	L3847P	probably damaging	Het
Tsks	C	T	7: 44,952,688	S276L	probably benign	Het
Uggt1	T	C	1: 36,146,106	E1519G	probably damaging	Het
Vps13a	A	G	19: 16,654,339		probably null	Het
Wdfy4	A	G	14: 32,974,282	V2768A		Het
Wdr26	A	C	1: 181,181,324	I627R	probably benign	Het
Zfp160	T	A	17: 21,025,487	S100T	probably benign	Het

Other mutations in Cd86

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01464:Cd86	APN	16	36620953	missense	probably benign	0.04
IGL01723:Cd86	APN	16	36607124	missense	probably benign
IGL01834:Cd86	APN	16	36607119	missense	probably benign	0.20
IGL02554:Cd86	APN	16	36618485	missense	probably benign	0.01
IGL02714:Cd86	APN	16	36620928	missense	possibly damaging	0.49
R0032:Cd86	UTSW	16	36620873	missense	probably damaging	0.96
R0032:Cd86	UTSW	16	36620873	missense	probably damaging	0.96
R0315:Cd86	UTSW	16	36620944	missense	possibly damaging	0.88
R0494:Cd86	UTSW	16	36618637	splice site	probably benign
R1345:Cd86	UTSW	16	36618324	splice site	probably null
R1459:Cd86	UTSW	16	36628988	missense	probably benign	0.09
R1616:Cd86	UTSW	16	36628976	missense	probably benign	0.00
R4436:Cd86	UTSW	16	36620832	missense	probably benign	0.04
R4593:Cd86	UTSW	16	36606556	makesense	probably null
R4612:Cd86	UTSW	16	36615330	missense	probably benign	0.00
R6058:Cd86	UTSW	16	36629015	missense	possibly damaging	0.91
R7140:Cd86	UTSW	16	36620901	missense	probably benign	0.09
R7174:Cd86	UTSW	16	36606555	frame shift	probably null
R7176:Cd86	UTSW	16	36606555	frame shift	probably null
R7177:Cd86	UTSW	16	36606555	frame shift	probably null
R7181:Cd86	UTSW	16	36606555	frame shift	probably null
R7183:Cd86	UTSW	16	36606555	frame shift	probably null
R7232:Cd86	UTSW	16	36606555	frame shift	probably null
R7256:Cd86	UTSW	16	36606555	frame shift	probably null
R7267:Cd86	UTSW	16	36606555	frame shift	probably null
R8826:Cd86	UTSW	16	36615288	missense	possibly damaging	0.45

Predicted Primers

PCR Primer
(F):5'- GACACTGCCACCTGTTTATGG -3'
(R):5'- ATATGAGGGTGGTTTTATGTCCAAC -3'

Sequencing Primer
(F):5'- CACCTGTTTATGGCTACTTTCC -3'
(R):5'- GGTGGTTTTATGTCCAACATTAGAAG -3'

Posted On

2019-06-26