Incidental Mutation 'R7255:Sema6b'
ID 564233
Institutional Source Beutler Lab
Gene Symbol Sema6b
Ensembl Gene ENSMUSG00000001227
Gene Name sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B
Synonyms Sema, Seman, semaZ, VIb
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock # R7255 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 56123085-56140343 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 56125336 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 581 (T581A)
Ref Sequence ENSEMBL: ENSMUSP00000001256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001256] [ENSMUST00000041357] [ENSMUST00000167545]
AlphaFold O54951
Predicted Effect probably benign
Transcript: ENSMUST00000001256
AA Change: T581A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000001256
Gene: ENSMUSG00000001227
AA Change: T581A

DomainStartEndE-ValueType
low complexity region 13 21 N/A INTRINSIC
Sema 66 496 2.48e-177 SMART
PSI 527 581 4.09e-1 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 655 685 N/A INTRINSIC
low complexity region 707 718 N/A INTRINSIC
low complexity region 739 760 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041357
SMART Domains Protein: ENSMUSP00000038048
Gene: ENSMUSG00000037095

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRR 84 107 1.86e0 SMART
LRR_TYP 108 131 3.63e-3 SMART
LRR 133 155 5.89e1 SMART
LRR_TYP 156 179 1.45e-2 SMART
LRR_TYP 180 203 8.47e-4 SMART
LRR 205 227 2.08e1 SMART
LRR 229 251 1.91e1 SMART
LRR 252 275 5.34e-1 SMART
LRRCT 292 342 9.69e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167545
AA Change: T581A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000130985
Gene: ENSMUSG00000001227
AA Change: T581A

DomainStartEndE-ValueType
low complexity region 13 21 N/A INTRINSIC
Sema 66 496 2.48e-177 SMART
PSI 527 581 4.09e-1 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 655 685 N/A INTRINSIC
low complexity region 707 718 N/A INTRINSIC
low complexity region 739 760 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family, a group of proteins characterized by the presence of a conserved semaphorin (sema) domain. Whereas some semaphorins are transmembrane proteins, others are secreted. Semaphorins play a major role in axon guidance. The protein encoded by this gene may be involved in both peripheral and central nervous system development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal mossy fiber and mossy cell axon projections, thickened suprapyramidal bundles, and elongated infrapyramydal bundles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G A 11: 23,620,465 P145L probably benign Het
9530003J23Rik T C 10: 117,234,422 H150R probably benign Het
Aldh1a7 A G 19: 20,714,728 S234P probably damaging Het
Arhgap28 T C 17: 67,853,004 H650R probably damaging Het
Asic1 A G 15: 99,697,457 D355G probably damaging Het
Atp8b1 T A 18: 64,556,868 S598C probably damaging Het
Bcat1 C A 6: 145,032,785 E237* probably null Het
Btbd16 A T 7: 130,785,992 I114F probably benign Het
Casp2 A G 6: 42,268,907 D166G probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cpsf1 G A 15: 76,597,543 T1099M probably damaging Het
Crisp4 C A 1: 18,130,231 A116S probably damaging Het
Cyb5r3 A G 15: 83,160,165 I168T probably damaging Het
Dip2b G A 15: 100,209,627 D1407N probably benign Het
Dnajc8 A G 4: 132,551,573 K201R probably benign Het
Dock10 C T 1: 80,543,099 probably null Het
Dopey2 C A 16: 93,770,146 H1272N probably damaging Het
Dsc1 C T 18: 20,097,273 R325Q probably benign Het
Enpp1 A T 10: 24,645,315 I838K possibly damaging Het
Fcna T G 2: 25,626,028 D159A probably damaging Het
Flnc G T 6: 29,445,766 G840C probably damaging Het
Flt1 C T 5: 147,580,406 A1024T probably damaging Het
Galc T C 12: 98,246,255 K207R probably null Het
Gbp2b T A 3: 142,608,117 L386Q probably damaging Het
Gm8297 T A 14: 4,984,874 N48K probably damaging Het
Gm9639 G A 10: 77,794,538 P180L unknown Het
Inpp5a A G 7: 139,511,448 N116S probably damaging Het
Ipo9 T C 1: 135,385,988 E984G probably benign Het
Klra4 A G 6: 130,059,642 F145L probably damaging Het
Lag3 A G 6: 124,910,235 L123P probably benign Het
Med7 T A 11: 46,440,995 M139K probably damaging Het
Mfsd2a A C 4: 122,952,021 L153R possibly damaging Het
Mup9 A G 4: 60,421,337 V71A probably benign Het
Myo16 A T 8: 10,499,169 Q927L unknown Het
Myo9b T C 8: 71,290,891 Y199H probably damaging Het
Nefm A G 14: 68,116,000 F406L probably benign Het
Olfr1123 T A 2: 87,418,942 L296Q probably damaging Het
Olfr1333 A T 4: 118,829,952 F162I probably benign Het
Pamr1 T C 2: 102,611,584 F173L probably damaging Het
Pds5b T A 5: 150,796,667 D1205E probably benign Het
Plxna2 T G 1: 194,752,103 F646V probably benign Het
Pnrc1 C T 4: 33,248,045 G118D probably benign Het
Ppp1r16b T C 2: 158,761,391 F412S probably benign Het
Prcc A T 3: 87,870,091 V192E probably damaging Het
Psg19 A G 7: 18,794,048 Y257H probably benign Het
Rfx7 T G 9: 72,619,828 S1433R possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Sbspon G T 1: 15,883,797 C86* probably null Het
Sdhb A G 4: 140,977,418 E230G possibly damaging Het
Shkbp1 G T 7: 27,342,748 T594K possibly damaging Het
Shpk A G 11: 73,199,660 S48G probably benign Het
Slc1a3 A G 15: 8,642,999 V332A possibly damaging Het
Slc25a25 T C 2: 32,421,372 E135G possibly damaging Het
Slc5a8 A T 10: 88,909,631 D367V probably damaging Het
Slco1c1 A G 6: 141,569,325 T649A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats1 T A 17: 45,454,205 D163V probably damaging Het
Ssh2 T A 11: 77,425,593 M304K probably damaging Het
Sulf1 T A 1: 12,859,008 D166E probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Tcf7l1 A T 6: 72,627,347 probably null Het
Tet1 A T 10: 62,822,636 M1477K probably benign Het
Tlr5 T C 1: 182,974,316 F395S probably damaging Het
Trrap T C 5: 144,858,954 L3847P probably damaging Het
Tsks C T 7: 44,952,688 S276L probably benign Het
Uggt1 T C 1: 36,146,106 E1519G probably damaging Het
Vps13a A G 19: 16,654,339 probably null Het
Wdfy4 A G 14: 32,974,282 V2768A Het
Wdr26 A C 1: 181,181,324 I627R probably benign Het
Zfp160 T A 17: 21,025,487 S100T probably benign Het
Other mutations in Sema6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Sema6b APN 17 56130048 missense probably damaging 1.00
IGL01102:Sema6b APN 17 56132761 missense possibly damaging 0.91
IGL01533:Sema6b APN 17 56129499 splice site probably benign
IGL01611:Sema6b APN 17 56129969 splice site probably null
IGL01996:Sema6b APN 17 56131157 missense probably damaging 1.00
IGL02118:Sema6b APN 17 56132821 missense probably benign
R0010:Sema6b UTSW 17 56124105 missense probably benign 0.06
R0066:Sema6b UTSW 17 56128271 missense possibly damaging 0.83
R0066:Sema6b UTSW 17 56128271 missense possibly damaging 0.83
R0525:Sema6b UTSW 17 56126630 missense probably damaging 0.96
R0635:Sema6b UTSW 17 56129971 critical splice donor site probably null
R1129:Sema6b UTSW 17 56124347 missense probably benign
R1927:Sema6b UTSW 17 56132797 missense probably benign 0.00
R2211:Sema6b UTSW 17 56124741 missense probably benign 0.00
R4081:Sema6b UTSW 17 56128307 missense probably damaging 0.99
R5013:Sema6b UTSW 17 56132497 critical splice donor site probably null
R5296:Sema6b UTSW 17 56127091 critical splice acceptor site probably null
R5314:Sema6b UTSW 17 56128413 nonsense probably null
R6317:Sema6b UTSW 17 56124047 missense probably benign 0.26
R6419:Sema6b UTSW 17 56132784 nonsense probably null
R7289:Sema6b UTSW 17 56125573 missense possibly damaging 0.77
R7805:Sema6b UTSW 17 56131555 missense probably damaging 1.00
R8157:Sema6b UTSW 17 56128448 missense probably damaging 1.00
R8290:Sema6b UTSW 17 56124803 missense possibly damaging 0.93
R8305:Sema6b UTSW 17 56127084 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGGATCTCATTTTCACCC -3'
(R):5'- TCCTCAGACCAGGAACTAGG -3'

Sequencing Primer
(F):5'- TTGCAGCAGCCACCAGAG -3'
(R):5'- CCAGGAACTAGGTATGAGAGCTG -3'
Posted On 2019-06-26