Mutagenetix > Incidental Mutation

Incidental Mutation 'R7255:Arhgap28'

564234

Institutional Source

Beutler Lab

Gene Symbol

Arhgap28

Ensembl Gene

ENSMUSG00000024043

Gene Name

Rho GTPase activating protein 28

Synonyms

MMRRC Submission

045316-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7255 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

67842713-68004120 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 67853004 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 650 (H650R)

Ref Sequence

ENSEMBL: ENSMUSP00000024840 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024840] [ENSMUST00000163865] [ENSMUST00000164647]

AlphaFold

Q8BN58

Predicted Effect

probably damaging
Transcript: ENSMUST00000024840
AA Change: H650R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000024840
Gene: ENSMUSG00000024043
AA Change: H650R

Domain	Start	End	E-Value	Type
low complexity region	63	76	N/A	INTRINSIC
RhoGAP	400	578	1.41e-34	SMART
Blast:RhoGAP	583	612	2e-7	BLAST
Blast:RhoGAP	640	681	9e-6	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000163865
AA Change: H599R

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000130960
Gene: ENSMUSG00000024043
AA Change: H599R

Domain	Start	End	E-Value	Type
low complexity region	13	26	N/A	INTRINSIC
RhoGAP	350	527	7.1e-31	SMART
Blast:RhoGAP	532	561	1e-7	BLAST
Blast:RhoGAP	589	630	8e-6	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000164647
AA Change: H600R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000128194
Gene: ENSMUSG00000024043
AA Change: H600R

Domain	Start	End	E-Value	Type
low complexity region	13	26	N/A	INTRINSIC
RhoGAP	350	528	1.41e-34	SMART
Blast:RhoGAP	533	562	1e-7	BLAST
Blast:RhoGAP	590	631	8e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000170813

SMART Domains

Protein: ENSMUSP00000132087
Gene: ENSMUSG00000024043

Domain	Start	End	E-Value	Type
RhoGAP	87	208	7.57e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

97% (66/68)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal bone length and ossification. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	G	A	11: 23,620,465	P145L	probably benign	Het
9530003J23Rik	T	C	10: 117,234,422	H150R	probably benign	Het
Aldh1a7	A	G	19: 20,714,728	S234P	probably damaging	Het
Asic1	A	G	15: 99,697,457	D355G	probably damaging	Het
Atp8b1	T	A	18: 64,556,868	S598C	probably damaging	Het
Bcat1	C	A	6: 145,032,785	E237*	probably null	Het
Btbd16	A	T	7: 130,785,992	I114F	probably benign	Het
Casp2	A	G	6: 42,268,907	D166G	probably damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cpsf1	G	A	15: 76,597,543	T1099M	probably damaging	Het
Crisp4	C	A	1: 18,130,231	A116S	probably damaging	Het
Cyb5r3	A	G	15: 83,160,165	I168T	probably damaging	Het
Dip2b	G	A	15: 100,209,627	D1407N	probably benign	Het
Dnajc8	A	G	4: 132,551,573	K201R	probably benign	Het
Dock10	C	T	1: 80,543,099		probably null	Het
Dopey2	C	A	16: 93,770,146	H1272N	probably damaging	Het
Dsc1	C	T	18: 20,097,273	R325Q	probably benign	Het
Enpp1	A	T	10: 24,645,315	I838K	possibly damaging	Het
Fcna	T	G	2: 25,626,028	D159A	probably damaging	Het
Flnc	G	T	6: 29,445,766	G840C	probably damaging	Het
Flt1	C	T	5: 147,580,406	A1024T	probably damaging	Het
Galc	T	C	12: 98,246,255	K207R	probably null	Het
Gbp2b	T	A	3: 142,608,117	L386Q	probably damaging	Het
Gm8297	T	A	14: 4,984,874	N48K	probably damaging	Het
Gm9639	G	A	10: 77,794,538	P180L	unknown	Het
Inpp5a	A	G	7: 139,511,448	N116S	probably damaging	Het
Ipo9	T	C	1: 135,385,988	E984G	probably benign	Het
Klra4	A	G	6: 130,059,642	F145L	probably damaging	Het
Lag3	A	G	6: 124,910,235	L123P	probably benign	Het
Med7	T	A	11: 46,440,995	M139K	probably damaging	Het
Mfsd2a	A	C	4: 122,952,021	L153R	possibly damaging	Het
Mup9	A	G	4: 60,421,337	V71A	probably benign	Het
Myo16	A	T	8: 10,499,169	Q927L	unknown	Het
Myo9b	T	C	8: 71,290,891	Y199H	probably damaging	Het
Nefm	A	G	14: 68,116,000	F406L	probably benign	Het
Olfr1123	T	A	2: 87,418,942	L296Q	probably damaging	Het
Olfr1333	A	T	4: 118,829,952	F162I	probably benign	Het
Pamr1	T	C	2: 102,611,584	F173L	probably damaging	Het
Pds5b	T	A	5: 150,796,667	D1205E	probably benign	Het
Plxna2	T	G	1: 194,752,103	F646V	probably benign	Het
Pnrc1	C	T	4: 33,248,045	G118D	probably benign	Het
Ppp1r16b	T	C	2: 158,761,391	F412S	probably benign	Het
Prcc	A	T	3: 87,870,091	V192E	probably damaging	Het
Psg19	A	G	7: 18,794,048	Y257H	probably benign	Het
Rfx7	T	G	9: 72,619,828	S1433R	possibly damaging	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Sbspon	G	T	1: 15,883,797	C86*	probably null	Het
Sdhb	A	G	4: 140,977,418	E230G	possibly damaging	Het
Sema6b	T	C	17: 56,125,336	T581A	probably benign	Het
Shkbp1	G	T	7: 27,342,748	T594K	possibly damaging	Het
Shpk	A	G	11: 73,199,660	S48G	probably benign	Het
Slc1a3	A	G	15: 8,642,999	V332A	possibly damaging	Het
Slc25a25	T	C	2: 32,421,372	E135G	possibly damaging	Het
Slc5a8	A	T	10: 88,909,631	D367V	probably damaging	Het
Slco1c1	A	G	6: 141,569,325	T649A	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spats1	T	A	17: 45,454,205	D163V	probably damaging	Het
Ssh2	T	A	11: 77,425,593	M304K	probably damaging	Het
Sulf1	T	A	1: 12,859,008	D166E	probably benign	Het
Syne1	A	G	10: 5,333,446	S1540P	probably damaging	Het
Tcf7l1	A	T	6: 72,627,347		probably null	Het
Tet1	A	T	10: 62,822,636	M1477K	probably benign	Het
Tlr5	T	C	1: 182,974,316	F395S	probably damaging	Het
Trrap	T	C	5: 144,858,954	L3847P	probably damaging	Het
Tsks	C	T	7: 44,952,688	S276L	probably benign	Het
Uggt1	T	C	1: 36,146,106	E1519G	probably damaging	Het
Vps13a	A	G	19: 16,654,339		probably null	Het
Wdfy4	A	G	14: 32,974,282	V2768A		Het
Wdr26	A	C	1: 181,181,324	I627R	probably benign	Het
Zfp160	T	A	17: 21,025,487	S100T	probably benign	Het

Other mutations in Arhgap28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Arhgap28	APN	17	67845801	missense	probably damaging	1.00
IGL01388:Arhgap28	APN	17	67853039	unclassified	probably benign
IGL01560:Arhgap28	APN	17	67896071	missense	probably damaging	1.00
IGL01578:Arhgap28	APN	17	67858200	missense	probably benign	0.00
IGL01650:Arhgap28	APN	17	67873132	missense	probably damaging	0.97
IGL02383:Arhgap28	APN	17	67896089	missense	probably benign	0.00
IGL02403:Arhgap28	APN	17	67873159	missense	possibly damaging	0.87
IGL02652:Arhgap28	APN	17	67884800	missense	probably benign	0.00
IGL03102:Arhgap28	APN	17	67896236	missense	probably damaging	1.00
IGL03209:Arhgap28	APN	17	67868956	missense	probably damaging	1.00
IGL03306:Arhgap28	APN	17	67852935	missense	probably damaging	1.00
K3955:Arhgap28	UTSW	17	68004006	missense	probably damaging	0.98
PIT4445001:Arhgap28	UTSW	17	67896235	missense	possibly damaging	0.94
R0135:Arhgap28	UTSW	17	67864588	missense	probably damaging	1.00
R0309:Arhgap28	UTSW	17	67901429	missense	probably benign	0.13
R0385:Arhgap28	UTSW	17	67864606	missense	probably damaging	1.00
R0412:Arhgap28	UTSW	17	67896258	missense	probably damaging	1.00
R0463:Arhgap28	UTSW	17	67896225	missense	probably damaging	1.00
R0626:Arhgap28	UTSW	17	67896113	splice site	probably null
R0691:Arhgap28	UTSW	17	67896164	splice site	probably null
R0811:Arhgap28	UTSW	17	67901299	small deletion	probably benign
R1150:Arhgap28	UTSW	17	67857464	missense	probably damaging	1.00
R1151:Arhgap28	UTSW	17	67857464	missense	probably damaging	1.00
R1152:Arhgap28	UTSW	17	67857464	missense	probably damaging	1.00
R1426:Arhgap28	UTSW	17	67857464	missense	probably damaging	1.00
R1427:Arhgap28	UTSW	17	67857464	missense	probably damaging	1.00
R1632:Arhgap28	UTSW	17	67849074	missense	probably damaging	0.99
R1747:Arhgap28	UTSW	17	67901309	missense	probably benign	0.02
R1951:Arhgap28	UTSW	17	67901341	missense	probably benign	0.00
R2031:Arhgap28	UTSW	17	67896116	missense	probably damaging	1.00
R2126:Arhgap28	UTSW	17	67869015	missense	possibly damaging	0.90
R2181:Arhgap28	UTSW	17	67896117	missense	probably damaging	1.00
R3700:Arhgap28	UTSW	17	67901366	missense	probably damaging	1.00
R3800:Arhgap28	UTSW	17	67873036	missense	probably damaging	1.00
R3811:Arhgap28	UTSW	17	67896093	missense	probably benign
R4213:Arhgap28	UTSW	17	67871993	missense	probably benign	0.04
R4347:Arhgap28	UTSW	17	67873142	missense	probably benign
R4954:Arhgap28	UTSW	17	67869013	nonsense	probably null
R5592:Arhgap28	UTSW	17	67858272	missense	probably damaging	0.99
R5610:Arhgap28	UTSW	17	67896240	nonsense	probably null
R5758:Arhgap28	UTSW	17	67873159	missense	probably benign	0.04
R5774:Arhgap28	UTSW	17	67881492	missense	possibly damaging	0.94
R6413:Arhgap28	UTSW	17	67875588	missense	probably benign	0.00
R6661:Arhgap28	UTSW	17	67845751	missense	probably damaging	1.00
R7324:Arhgap28	UTSW	17	67895884	splice site	probably null
R7338:Arhgap28	UTSW	17	67896111	missense	probably damaging	1.00
R7549:Arhgap28	UTSW	17	67871966	missense	probably damaging	1.00
R7860:Arhgap28	UTSW	17	67901282	nonsense	probably null
R8516:Arhgap28	UTSW	17	67873073	missense	probably benign	0.08
R9210:Arhgap28	UTSW	17	67855435	missense	probably benign	0.00
R9212:Arhgap28	UTSW	17	67855435	missense	probably benign	0.00
R9779:Arhgap28	UTSW	17	67845769	missense	probably benign	0.00
Z1088:Arhgap28	UTSW	17	67861277	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- CTGCAATTGTTCAGAAGCCC -3'
(R):5'- TAGAGTCCCAGGTCGGATTTG -3'

Sequencing Primer
(F):5'- TTGTTCAGAAGCCCACAGC -3'
(R):5'- GTTGACCTTGTGGGAGAGAAG -3'

Posted On

2019-06-26