Mutagenetix > Incidental Mutations

Incidental Mutation 'R7255:Vps13a'

564237

Institutional Source

Beutler Lab

Gene Symbol

Vps13a

Ensembl Gene

ENSMUSG00000046230

Gene Name

vacuolar protein sorting 13A

Synonyms

4930516E05Rik, 4930543C13Rik, D330038K10Rik

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_173028.4; MGI:2444304

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7255 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

16615366-16780933 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 16654339 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000068716 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068156] [ENSMUST00000224149]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000068156

SMART Domains

Protein: ENSMUSP00000068716
Gene: ENSMUSG00000046230

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	3	117	5.4e-38	PFAM
Pfam:VPS13	139	371	3.7e-64	PFAM
low complexity region	553	563	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	567	791	1.4e-69	PFAM
Pfam:VPS13_mid_rpt	1138	1329	2e-10	PFAM
low complexity region	1367	1377	N/A	INTRINSIC
Blast:INB	1575	1855	1e-149	BLAST
Pfam:SHR-BD	2200	2449	1.3e-35	PFAM
low complexity region	2510	2521	N/A	INTRINSIC
low complexity region	2632	2648	N/A	INTRINSIC
low complexity region	2719	2731	N/A	INTRINSIC
Pfam:VPS13_C	2755	2935	8.9e-66	PFAM
Pfam:ATG_C	2938	3029	1.6e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000224149

Predicted Effect

probably null
Transcript: ENSMUST00000225233

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

97% (66/68)

MGI Phenotype

Strain: 3531502
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aging mice homozygous for a knock-out allele display motor dysfunction and abnormal social interaction, hematologic anomalies including acanthocytosis, selective atrophy of the striatum with significant apoptosis and gliosis, and reduced homovanillic acid levels in midbrain. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(5)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	G	A	11: 23,620,465	P145L	probably benign	Het
9530003J23Rik	T	C	10: 117,234,422	H150R	probably benign	Het
Aldh1a7	A	G	19: 20,714,728	S234P	probably damaging	Het
Arhgap28	T	C	17: 67,853,004	H650R	probably damaging	Het
Asic1	A	G	15: 99,697,457	D355G	probably damaging	Het
Atp8b1	T	A	18: 64,556,868	S598C	probably damaging	Het
Bcat1	C	A	6: 145,032,785	E237*	probably null	Het
Btbd16	A	T	7: 130,785,992	I114F	probably benign	Het
Casp2	A	G	6: 42,268,907	D166G	probably damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cpsf1	G	A	15: 76,597,543	T1099M	probably damaging	Het
Crisp4	C	A	1: 18,130,231	A116S	probably damaging	Het
Cyb5r3	A	G	15: 83,160,165	I168T	probably damaging	Het
Dip2b	G	A	15: 100,209,627	D1407N	probably benign	Het
Dnajc8	A	G	4: 132,551,573	K201R	probably benign	Het
Dock10	C	T	1: 80,543,099		probably null	Het
Dopey2	C	A	16: 93,770,146	H1272N	probably damaging	Het
Dsc1	C	T	18: 20,097,273	R325Q	probably benign	Het
Enpp1	A	T	10: 24,645,315	I838K	possibly damaging	Het
Fcna	T	G	2: 25,626,028	D159A	probably damaging	Het
Flnc	G	T	6: 29,445,766	G840C	probably damaging	Het
Flt1	C	T	5: 147,580,406	A1024T	probably damaging	Het
Galc	T	C	12: 98,246,255	K207R	probably null	Het
Gbp2b	T	A	3: 142,608,117	L386Q	probably damaging	Het
Gm8297	T	A	14: 4,984,874	N48K	probably damaging	Het
Gm9639	G	A	10: 77,794,538	P180L	unknown	Het
Inpp5a	A	G	7: 139,511,448	N116S	probably damaging	Het
Ipo9	T	C	1: 135,385,988	E984G	probably benign	Het
Klra4	A	G	6: 130,059,642	F145L	probably damaging	Het
Lag3	A	G	6: 124,910,235	L123P	probably benign	Het
Med7	T	A	11: 46,440,995	M139K	probably damaging	Het
Mfsd2a	A	C	4: 122,952,021	L153R	possibly damaging	Het
Mup9	A	G	4: 60,421,337	V71A	probably benign	Het
Myo16	A	T	8: 10,499,169	Q927L	unknown	Het
Myo9b	T	C	8: 71,290,891	Y199H	probably damaging	Het
Nefm	A	G	14: 68,116,000	F406L	probably benign	Het
Olfr1123	T	A	2: 87,418,942	L296Q	probably damaging	Het
Olfr1333	A	T	4: 118,829,952	F162I	probably benign	Het
Pamr1	T	C	2: 102,611,584	F173L	probably damaging	Het
Pds5b	T	A	5: 150,796,667	D1205E	probably benign	Het
Plxna2	T	G	1: 194,752,103	F646V	probably benign	Het
Pnrc1	C	T	4: 33,248,045	G118D	probably benign	Het
Ppp1r16b	T	C	2: 158,761,391	F412S	probably benign	Het
Prcc	A	T	3: 87,870,091	V192E	probably damaging	Het
Psg19	A	G	7: 18,794,048	Y257H	probably benign	Het
Rfx7	T	G	9: 72,619,828	S1433R	possibly damaging	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Sbspon	G	T	1: 15,883,797	C86*	probably null	Het
Sdhb	A	G	4: 140,977,418	E230G	possibly damaging	Het
Sema6b	T	C	17: 56,125,336	T581A	probably benign	Het
Shkbp1	G	T	7: 27,342,748	T594K	possibly damaging	Het
Shpk	A	G	11: 73,199,660	S48G	probably benign	Het
Slc1a3	A	G	15: 8,642,999	V332A	possibly damaging	Het
Slc25a25	T	C	2: 32,421,372	E135G	possibly damaging	Het
Slc5a8	A	T	10: 88,909,631	D367V	probably damaging	Het
Slco1c1	A	G	6: 141,569,325	T649A	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spats1	T	A	17: 45,454,205	D163V	probably damaging	Het
Ssh2	T	A	11: 77,425,593	M304K	probably damaging	Het
Sulf1	T	A	1: 12,859,008	D166E	probably benign	Het
Syne1	A	G	10: 5,333,446	S1540P	probably damaging	Het
Tcf7l1	A	T	6: 72,627,347		probably null	Het
Tet1	A	T	10: 62,822,636	M1477K	probably benign	Het
Tlr5	T	C	1: 182,974,316	F395S	probably damaging	Het
Trrap	T	C	5: 144,858,954	L3847P	probably damaging	Het
Tsks	C	T	7: 44,952,688	S276L	probably benign	Het
Uggt1	T	C	1: 36,146,106	E1519G	probably damaging	Het
Wdfy4	A	G	14: 32,974,282	V2768A		Het
Wdr26	A	C	1: 181,181,324	I627R	probably benign	Het
Zfp160	T	A	17: 21,025,487	S100T	probably benign	Het

Other mutations in Vps13a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Vps13a	APN	19	16752175	missense	probably damaging	0.98
IGL00537:Vps13a	APN	19	16680045	missense	probably benign	0.03
IGL00562:Vps13a	APN	19	16734714	critical splice donor site	probably null
IGL00563:Vps13a	APN	19	16734714	critical splice donor site	probably null
IGL00579:Vps13a	APN	19	16707362	missense	probably benign	0.29
IGL00662:Vps13a	APN	19	16704540	missense	probably damaging	0.96
IGL00667:Vps13a	APN	19	16759676	missense	probably damaging	1.00
IGL01102:Vps13a	APN	19	16651417	critical splice donor site	probably null
IGL01139:Vps13a	APN	19	16640625	missense	probably damaging	0.99
IGL01142:Vps13a	APN	19	16687115	missense	possibly damaging	0.86
IGL01361:Vps13a	APN	19	16743007	missense	probably damaging	1.00
IGL01386:Vps13a	APN	19	16701152	missense	possibly damaging	0.87
IGL01593:Vps13a	APN	19	16762181	missense	probably damaging	0.98
IGL01700:Vps13a	APN	19	16744857	nonsense	probably null
IGL01767:Vps13a	APN	19	16663894	missense	probably damaging	1.00
IGL01782:Vps13a	APN	19	16754337	missense	probably damaging	0.98
IGL01808:Vps13a	APN	19	16710286	missense	probably damaging	1.00
IGL01812:Vps13a	APN	19	16715060	missense	probably benign
IGL01829:Vps13a	APN	19	16619443	missense	probably benign	0.01
IGL01893:Vps13a	APN	19	16663775	missense	probably damaging	1.00
IGL02222:Vps13a	APN	19	16682175	missense	probably benign	0.06
IGL02295:Vps13a	APN	19	16715042	splice site	probably benign
IGL02465:Vps13a	APN	19	16710941	missense	probably benign	0.11
IGL02492:Vps13a	APN	19	16647637	missense	probably damaging	1.00
IGL02581:Vps13a	APN	19	16655322	missense	probably benign	0.41
IGL02633:Vps13a	APN	19	16720408	missense	possibly damaging	0.82
IGL02641:Vps13a	APN	19	16698821	missense	probably benign	0.01
IGL02659:Vps13a	APN	19	16652699	missense	probably damaging	1.00
IGL02827:Vps13a	APN	19	16641634	missense	possibly damaging	0.91
IGL02943:Vps13a	APN	19	16663886	missense	probably damaging	1.00
IGL03057:Vps13a	APN	19	16668694	missense	probably damaging	1.00
IGL03077:Vps13a	APN	19	16710882	missense	probably benign
IGL03184:Vps13a	APN	19	16654370	missense	probably benign	0.00
eggs	UTSW	19	16701165	missense	probably damaging	1.00
excambio	UTSW	19	16745947	splice site	probably null
Faster	UTSW	19	16619485	missense	probably damaging	1.00
Ham	UTSW	19	16677969	missense	probably benign	0.08
interchange	UTSW	19	16668690	missense	probably damaging	1.00
PIT4377001:Vps13a	UTSW	19	16740901	missense	probably damaging	1.00
R0045:Vps13a	UTSW	19	16640810	nonsense	probably null
R0045:Vps13a	UTSW	19	16640810	nonsense	probably null
R0048:Vps13a	UTSW	19	16676140	missense	probably damaging	1.00
R0062:Vps13a	UTSW	19	16668690	missense	probably damaging	1.00
R0062:Vps13a	UTSW	19	16668690	missense	probably damaging	1.00
R0107:Vps13a	UTSW	19	16691824	missense	probably benign	0.03
R0135:Vps13a	UTSW	19	16780765	missense	probably damaging	1.00
R0138:Vps13a	UTSW	19	16660499	missense	possibly damaging	0.95
R0346:Vps13a	UTSW	19	16677969	missense	probably benign	0.08
R0359:Vps13a	UTSW	19	16641577	missense	probably damaging	0.99
R0530:Vps13a	UTSW	19	16655206	splice site	probably benign
R0541:Vps13a	UTSW	19	16704577	missense	probably benign	0.00
R0614:Vps13a	UTSW	19	16652694	missense	probably damaging	1.00
R0685:Vps13a	UTSW	19	16780741	missense	probably damaging	1.00
R0801:Vps13a	UTSW	19	16686656	splice site	probably benign
R0835:Vps13a	UTSW	19	16734882	splice site	probably null
R0848:Vps13a	UTSW	19	16698897	missense	probably damaging	1.00
R1114:Vps13a	UTSW	19	16750151	missense	probably benign	0.41
R1205:Vps13a	UTSW	19	16640541	missense	probably damaging	1.00
R1365:Vps13a	UTSW	19	16619446	missense	probably damaging	1.00
R1445:Vps13a	UTSW	19	16701238	nonsense	probably null
R1451:Vps13a	UTSW	19	16710864	missense	probably benign	0.01
R1479:Vps13a	UTSW	19	16750114	splice site	probably benign
R1533:Vps13a	UTSW	19	16701130	nonsense	probably null
R1600:Vps13a	UTSW	19	16666272	missense	probably benign	0.01
R1870:Vps13a	UTSW	19	16759952	missense	probably damaging	1.00
R1871:Vps13a	UTSW	19	16664664	missense	probably benign	0.01
R1959:Vps13a	UTSW	19	16677938	missense	possibly damaging	0.49
R1960:Vps13a	UTSW	19	16725631	missense	probably damaging	1.00
R1993:Vps13a	UTSW	19	16722458	missense	probably benign	0.07
R2257:Vps13a	UTSW	19	16682174	missense	possibly damaging	0.85
R2276:Vps13a	UTSW	19	16710426	missense	possibly damaging	0.47
R2326:Vps13a	UTSW	19	16743057	missense	possibly damaging	0.71
R2338:Vps13a	UTSW	19	16720453	missense	probably damaging	1.00
R2359:Vps13a	UTSW	19	16652679	splice site	probably benign
R2421:Vps13a	UTSW	19	16759671	missense	probably benign
R2847:Vps13a	UTSW	19	16703599	missense	probably damaging	0.98
R3081:Vps13a	UTSW	19	16664737	missense	probably benign	0.02
R3522:Vps13a	UTSW	19	16766493	splice site	probably benign
R3613:Vps13a	UTSW	19	16685402	missense	probably damaging	1.00
R3797:Vps13a	UTSW	19	16745947	splice site	probably null
R3874:Vps13a	UTSW	19	16744953	missense	probably benign	0.01
R4032:Vps13a	UTSW	19	16616899	missense	probably damaging	1.00
R4111:Vps13a	UTSW	19	16640628	missense	probably damaging	1.00
R4383:Vps13a	UTSW	19	16701165	missense	probably damaging	1.00
R4504:Vps13a	UTSW	19	16695502	missense	possibly damaging	0.93
R4578:Vps13a	UTSW	19	16682110	missense	probably damaging	0.98
R4587:Vps13a	UTSW	19	16640039	missense	probably damaging	1.00
R4588:Vps13a	UTSW	19	16640039	missense	probably damaging	1.00
R4605:Vps13a	UTSW	19	16640039	missense	probably damaging	1.00
R4714:Vps13a	UTSW	19	16749856	missense	probably benign	0.01
R4756:Vps13a	UTSW	19	16655216	missense	probably benign	0.01
R4831:Vps13a	UTSW	19	16677992	missense	probably benign	0.04
R5068:Vps13a	UTSW	19	16746058	missense	probably benign	0.01
R5070:Vps13a	UTSW	19	16654484	missense	probably benign
R5082:Vps13a	UTSW	19	16744893	missense	probably damaging	1.00
R5182:Vps13a	UTSW	19	16695499	missense	possibly damaging	0.81
R5189:Vps13a	UTSW	19	16685315	missense	probably damaging	1.00
R5283:Vps13a	UTSW	19	16677970	missense	probably damaging	0.96
R5294:Vps13a	UTSW	19	16641667	missense	probably damaging	1.00
R5304:Vps13a	UTSW	19	16710387	missense	possibly damaging	0.78
R5554:Vps13a	UTSW	19	16722411	missense	probably damaging	1.00
R5592:Vps13a	UTSW	19	16725571	missense	probably damaging	1.00
R5611:Vps13a	UTSW	19	16725572	missense	probably damaging	1.00
R5665:Vps13a	UTSW	19	16668690	missense	probably damaging	1.00
R5671:Vps13a	UTSW	19	16715100	missense	probably benign	0.03
R5684:Vps13a	UTSW	19	16699045	missense	probably benign	0.00
R5767:Vps13a	UTSW	19	16664564	missense	probably damaging	1.00
R5810:Vps13a	UTSW	19	16666324	missense	probably benign	0.00
R5866:Vps13a	UTSW	19	16680023	missense	probably benign	0.04
R5886:Vps13a	UTSW	19	16664562	missense	probably benign	0.01
R5933:Vps13a	UTSW	19	16660530	missense	probably benign	0.34
R5965:Vps13a	UTSW	19	16619028	splice site	probably null
R6259:Vps13a	UTSW	19	16687170	nonsense	probably null
R6346:Vps13a	UTSW	19	16682214	missense	possibly damaging	0.94
R6459:Vps13a	UTSW	19	16664018	missense	possibly damaging	0.56
R6485:Vps13a	UTSW	19	16680050	missense	probably damaging	0.99
R6520:Vps13a	UTSW	19	16725579	missense	probably damaging	1.00
R6644:Vps13a	UTSW	19	16744919	missense	possibly damaging	0.90
R6932:Vps13a	UTSW	19	16678075	missense	probably benign	0.01
R6934:Vps13a	UTSW	19	16676194	missense	probably damaging	1.00
R6951:Vps13a	UTSW	19	16723740	missense	probably benign	0.00
R7027:Vps13a	UTSW	19	16664664	missense	probably benign	0.01
R7126:Vps13a	UTSW	19	16710879	missense	probably benign
R7206:Vps13a	UTSW	19	16754298	missense	probably damaging	1.00
R7248:Vps13a	UTSW	19	16678042	missense	probably benign	0.25
R7252:Vps13a	UTSW	19	16661064	missense	probably benign	0.00
R7382:Vps13a	UTSW	19	16619485	missense	probably damaging	1.00
R7422:Vps13a	UTSW	19	16750173	missense	probably damaging	1.00
R7425:Vps13a	UTSW	19	16723702	missense	probably benign	0.13
R7523:Vps13a	UTSW	19	16703789	missense	probably benign
R7586:Vps13a	UTSW	19	16647598	missense	probably benign	0.08
R7587:Vps13a	UTSW	19	16703789	missense	probably benign	0.00
R7593:Vps13a	UTSW	19	16725663	missense	probably damaging	1.00
R7637:Vps13a	UTSW	19	16750149	missense	probably benign	0.02
R7763:Vps13a	UTSW	19	16746000	missense	possibly damaging	0.95
R7813:Vps13a	UTSW	19	16651456	missense	possibly damaging	0.81
R7815:Vps13a	UTSW	19	16725572	missense	probably damaging	1.00
R7861:Vps13a	UTSW	19	16655304	missense	probably damaging	1.00
R7909:Vps13a	UTSW	19	16720430	nonsense	probably null
R7939:Vps13a	UTSW	19	16740791	missense	possibly damaging	0.94
R8108:Vps13a	UTSW	19	16640787	missense	probably damaging	1.00
R8123:Vps13a	UTSW	19	16647702	missense	probably benign	0.01
R8134:Vps13a	UTSW	19	16654354	missense	possibly damaging	0.71
R8168:Vps13a	UTSW	19	16749548	missense	probably benign	0.09
R8272:Vps13a	UTSW	19	16749845	critical splice donor site	probably null
R8293:Vps13a	UTSW	19	16668605	missense	possibly damaging	0.81
R8303:Vps13a	UTSW	19	16616906	missense	probably benign	0.00
R8383:Vps13a	UTSW	19	16723705	missense	possibly damaging	0.83
R8386:Vps13a	UTSW	19	16701119	critical splice donor site	probably null
R8433:Vps13a	UTSW	19	16741236	missense	possibly damaging	0.56
R8436:Vps13a	UTSW	19	16740793	missense	probably benign	0.10
R8450:Vps13a	UTSW	19	16654507	splice site	probably null
R8476:Vps13a	UTSW	19	16722457	missense	possibly damaging	0.60
R8501:Vps13a	UTSW	19	16682120	missense	probably benign	0.39
R8552:Vps13a	UTSW	19	16754320	missense	probably damaging	0.99
R8680:Vps13a	UTSW	19	16645906	missense	possibly damaging	0.84
R8784:Vps13a	UTSW	19	16664789	missense	probably damaging	1.00
R8871:Vps13a	UTSW	19	16663822	missense	probably damaging	1.00
R8945:Vps13a	UTSW	19	16664750	missense	probably damaging	1.00
R8948:Vps13a	UTSW	19	16745976	missense	probably damaging	0.99
R8950:Vps13a	UTSW	19	16745976	missense	probably damaging	0.99
R8960:Vps13a	UTSW	19	16705883	missense	possibly damaging	0.67
R9189:Vps13a	UTSW	19	16686597	missense	probably benign
R9366:Vps13a	UTSW	19	16695530	missense	probably damaging	1.00
X0061:Vps13a	UTSW	19	16645868	missense	probably benign	0.40
X0066:Vps13a	UTSW	19	16742553	missense	probably benign	0.33
Z1177:Vps13a	UTSW	19	16699113	critical splice acceptor site	probably null
Z31818:Vps13a	UTSW	19	16780754	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- GACTACAAGCATCCCTCCTG -3'
(R):5'- ACCCATCTCATTACGGAGGG -3'

Sequencing Primer
(F):5'- TTAGACAGAGTCTCATTCCACGG -3'
(R):5'- CTCATTACGGAGGGGCAATATTTTTC -3'

Posted On

2019-06-26