Incidental Mutation 'R7255:Aldh1a7'
ID 564238
Institutional Source Beutler Lab
Gene Symbol Aldh1a7
Ensembl Gene ENSMUSG00000024747
Gene Name aldehyde dehydrogenase family 1, subfamily A7
Synonyms Aldh-pb, Ahd2-like
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock # R7255 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 20692953-20727562 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20714728 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 234 (S234P)
Ref Sequence ENSEMBL: ENSMUSP00000025656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025656]
AlphaFold O35945
Predicted Effect probably damaging
Transcript: ENSMUST00000025656
AA Change: S234P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025656
Gene: ENSMUSG00000024747
AA Change: S234P

DomainStartEndE-ValueType
Pfam:Aldedh 29 492 2.5e-185 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G A 11: 23,620,465 P145L probably benign Het
9530003J23Rik T C 10: 117,234,422 H150R probably benign Het
Arhgap28 T C 17: 67,853,004 H650R probably damaging Het
Asic1 A G 15: 99,697,457 D355G probably damaging Het
Atp8b1 T A 18: 64,556,868 S598C probably damaging Het
Bcat1 C A 6: 145,032,785 E237* probably null Het
Btbd16 A T 7: 130,785,992 I114F probably benign Het
Casp2 A G 6: 42,268,907 D166G probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cpsf1 G A 15: 76,597,543 T1099M probably damaging Het
Crisp4 C A 1: 18,130,231 A116S probably damaging Het
Cyb5r3 A G 15: 83,160,165 I168T probably damaging Het
Dip2b G A 15: 100,209,627 D1407N probably benign Het
Dnajc8 A G 4: 132,551,573 K201R probably benign Het
Dock10 C T 1: 80,543,099 probably null Het
Dopey2 C A 16: 93,770,146 H1272N probably damaging Het
Dsc1 C T 18: 20,097,273 R325Q probably benign Het
Enpp1 A T 10: 24,645,315 I838K possibly damaging Het
Fcna T G 2: 25,626,028 D159A probably damaging Het
Flnc G T 6: 29,445,766 G840C probably damaging Het
Flt1 C T 5: 147,580,406 A1024T probably damaging Het
Galc T C 12: 98,246,255 K207R probably null Het
Gbp2b T A 3: 142,608,117 L386Q probably damaging Het
Gm8297 T A 14: 4,984,874 N48K probably damaging Het
Gm9639 G A 10: 77,794,538 P180L unknown Het
Inpp5a A G 7: 139,511,448 N116S probably damaging Het
Ipo9 T C 1: 135,385,988 E984G probably benign Het
Klra4 A G 6: 130,059,642 F145L probably damaging Het
Lag3 A G 6: 124,910,235 L123P probably benign Het
Med7 T A 11: 46,440,995 M139K probably damaging Het
Mfsd2a A C 4: 122,952,021 L153R possibly damaging Het
Mup9 A G 4: 60,421,337 V71A probably benign Het
Myo16 A T 8: 10,499,169 Q927L unknown Het
Myo9b T C 8: 71,290,891 Y199H probably damaging Het
Nefm A G 14: 68,116,000 F406L probably benign Het
Olfr1123 T A 2: 87,418,942 L296Q probably damaging Het
Olfr1333 A T 4: 118,829,952 F162I probably benign Het
Pamr1 T C 2: 102,611,584 F173L probably damaging Het
Pds5b T A 5: 150,796,667 D1205E probably benign Het
Plxna2 T G 1: 194,752,103 F646V probably benign Het
Pnrc1 C T 4: 33,248,045 G118D probably benign Het
Ppp1r16b T C 2: 158,761,391 F412S probably benign Het
Prcc A T 3: 87,870,091 V192E probably damaging Het
Psg19 A G 7: 18,794,048 Y257H probably benign Het
Rfx7 T G 9: 72,619,828 S1433R possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Sbspon G T 1: 15,883,797 C86* probably null Het
Sdhb A G 4: 140,977,418 E230G possibly damaging Het
Sema6b T C 17: 56,125,336 T581A probably benign Het
Shkbp1 G T 7: 27,342,748 T594K possibly damaging Het
Shpk A G 11: 73,199,660 S48G probably benign Het
Slc1a3 A G 15: 8,642,999 V332A possibly damaging Het
Slc25a25 T C 2: 32,421,372 E135G possibly damaging Het
Slc5a8 A T 10: 88,909,631 D367V probably damaging Het
Slco1c1 A G 6: 141,569,325 T649A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats1 T A 17: 45,454,205 D163V probably damaging Het
Ssh2 T A 11: 77,425,593 M304K probably damaging Het
Sulf1 T A 1: 12,859,008 D166E probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Tcf7l1 A T 6: 72,627,347 probably null Het
Tet1 A T 10: 62,822,636 M1477K probably benign Het
Tlr5 T C 1: 182,974,316 F395S probably damaging Het
Trrap T C 5: 144,858,954 L3847P probably damaging Het
Tsks C T 7: 44,952,688 S276L probably benign Het
Uggt1 T C 1: 36,146,106 E1519G probably damaging Het
Vps13a A G 19: 16,654,339 probably null Het
Wdfy4 A G 14: 32,974,282 V2768A Het
Wdr26 A C 1: 181,181,324 I627R probably benign Het
Zfp160 T A 17: 21,025,487 S100T probably benign Het
Other mutations in Aldh1a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Aldh1a7 APN 19 20700046 missense probably damaging 1.00
IGL01132:Aldh1a7 APN 19 20727040 missense possibly damaging 0.76
IGL01630:Aldh1a7 APN 19 20696329 splice site probably benign
IGL01901:Aldh1a7 APN 19 20717739 missense probably damaging 0.99
IGL02324:Aldh1a7 APN 19 20727004 missense probably damaging 1.00
IGL02822:Aldh1a7 APN 19 20702266 missense possibly damaging 0.85
IGL03162:Aldh1a7 APN 19 20708281 missense probably benign 0.21
PIT4514001:Aldh1a7 UTSW 19 20702240 missense probably benign 0.07
R0125:Aldh1a7 UTSW 19 20727066 splice site probably benign
R0268:Aldh1a7 UTSW 19 20709502 critical splice acceptor site probably null
R0833:Aldh1a7 UTSW 19 20702243 missense probably damaging 1.00
R1665:Aldh1a7 UTSW 19 20727461 missense probably benign
R1709:Aldh1a7 UTSW 19 20715952 missense probably damaging 1.00
R1772:Aldh1a7 UTSW 19 20716019 missense probably damaging 1.00
R1917:Aldh1a7 UTSW 19 20727455 missense probably benign
R2570:Aldh1a7 UTSW 19 20699956 missense probably benign 0.35
R3778:Aldh1a7 UTSW 19 20719311 missense possibly damaging 0.70
R3832:Aldh1a7 UTSW 19 20708238 missense probably damaging 1.00
R3894:Aldh1a7 UTSW 19 20696398 nonsense probably null
R4601:Aldh1a7 UTSW 19 20715979 missense probably damaging 0.98
R4948:Aldh1a7 UTSW 19 20727010 missense possibly damaging 0.77
R5562:Aldh1a7 UTSW 19 20702264 nonsense probably null
R5606:Aldh1a7 UTSW 19 20722367 missense probably damaging 1.00
R5641:Aldh1a7 UTSW 19 20715929 missense probably benign 0.00
R5808:Aldh1a7 UTSW 19 20708197 missense possibly damaging 0.79
R6646:Aldh1a7 UTSW 19 20699911 missense possibly damaging 0.94
R6759:Aldh1a7 UTSW 19 20699956 missense possibly damaging 0.89
R7034:Aldh1a7 UTSW 19 20708178 missense possibly damaging 0.95
R7036:Aldh1a7 UTSW 19 20708178 missense possibly damaging 0.95
R7150:Aldh1a7 UTSW 19 20716018 missense probably damaging 1.00
R7875:Aldh1a7 UTSW 19 20715979 missense possibly damaging 0.90
R7964:Aldh1a7 UTSW 19 20700007 missense probably damaging 0.99
R7964:Aldh1a7 UTSW 19 20716042 missense probably benign 0.05
R7984:Aldh1a7 UTSW 19 20709400 missense probably damaging 0.98
R8547:Aldh1a7 UTSW 19 20714703 missense possibly damaging 0.93
X0022:Aldh1a7 UTSW 19 20719315 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCATACTTTGAGTCTAGAATAAGG -3'
(R):5'- AACATAGTATCCCTCAGGGCCC -3'

Sequencing Primer
(F):5'- TTTGAGTCTAGAATAAGGAACAAACC -3'
(R):5'- TTCTTGTTAGAAGAACTCTCAAGGTG -3'
Posted On 2019-06-26