Incidental Mutation 'R7256:Olfr1097'
ID564244
Institutional Source Beutler Lab
Gene Symbol Olfr1097
Ensembl Gene ENSMUSG00000075170
Gene Nameolfactory receptor 1097
SynonymsMOR206-2, GA_x6K02T2Q125-48376288-48375341
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R7256 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86886773-86892216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86890612 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 188 (S188P)
Ref Sequence ENSEMBL: ENSMUSP00000150400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111576] [ENSMUST00000217403]
Predicted Effect probably damaging
Transcript: ENSMUST00000111576
AA Change: S188P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107202
Gene: ENSMUSG00000075170
AA Change: S188P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8e-52 PFAM
Pfam:7tm_1 41 312 4.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217403
AA Change: S188P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.3121 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,863,035 Y790H probably damaging Het
Bend3 A C 10: 43,493,671 S7R probably benign Het
Ccdc106 A G 7: 5,060,326 T277A probably damaging Het
Ccdc162 G A 10: 41,556,001 A1832V probably damaging Het
Ccser1 A G 6: 61,311,867 E338G probably benign Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cecr2 T C 6: 120,762,529 S1406P probably benign Het
Cep290 A G 10: 100,546,498 T208A probably damaging Het
Cep85l A C 10: 53,296,255 C569W probably damaging Het
Ces5a G A 8: 93,499,526 T527I probably benign Het
Clca2 T A 3: 145,090,847 I200F probably damaging Het
Cmas G A 6: 142,770,586 D251N probably damaging Het
Ctcfl G T 2: 173,118,475 A105E probably benign Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
Dctn6 A T 8: 34,090,808 I170N probably damaging Het
Dnah2 T C 11: 69,431,094 Y3800C probably damaging Het
Dsg2 G A 18: 20,591,931 V465I possibly damaging Het
Dzip1 T C 14: 118,885,646 T646A probably benign Het
Etv4 T A 11: 101,784,325 probably null Het
Exoc3l2 T C 7: 19,484,703 V549A unknown Het
Ficd G T 5: 113,738,819 A352S probably damaging Het
Fry T G 5: 150,466,786 I179S Het
Galntl5 A G 5: 25,195,300 H109R probably benign Het
Garem1 C A 18: 21,148,754 G182W probably damaging Het
Gm10696 T C 3: 94,176,360 E48G probably benign Het
Gm13078 T A 4: 143,726,279 D93E probably benign Het
Gm5916 A T 9: 36,120,989 Y50N possibly damaging Het
Gtf2h2 A T 13: 100,479,201 F271I probably benign Het
Hivep2 G T 10: 14,129,101 S481I probably benign Het
Homez T A 14: 54,857,420 Q277L probably damaging Het
Hoxb4 C A 11: 96,319,896 probably null Het
Igll1 A G 16: 16,861,093 S118P probably damaging Het
Ikzf2 A C 1: 69,578,053 probably null Het
Kif5b A G 18: 6,225,340 V230A probably damaging Het
Ldlr T A 9: 21,745,744 V719E probably benign Het
Lsm7 G A 10: 80,853,731 R66W possibly damaging Het
Map3k13 T A 16: 21,892,238 D90E probably benign Het
Mmrn1 A G 6: 60,976,114 K460E probably damaging Het
Myh10 A C 11: 68,790,689 N1061H probably damaging Het
Nepn A G 10: 52,400,993 Q275R probably benign Het
Noc3l A T 19: 38,812,356 D227E probably benign Het
Nploc4 G T 11: 120,428,550 S61R probably benign Het
Nr4a2 T C 2: 57,112,369 Y24C probably damaging Het
Nup160 T A 2: 90,723,355 I1143N probably damaging Het
Olfr1234 A T 2: 89,362,494 Y312N probably benign Het
Olfr294 G T 7: 86,615,665 H327N probably benign Het
Olfr895 T A 9: 38,268,708 M57K probably damaging Het
Papola T A 12: 105,809,345 C204S probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pgap1 A T 1: 54,493,207 probably null Het
Pitrm1 A G 13: 6,556,597 H229R probably damaging Het
Plcl1 A G 1: 55,698,218 Q906R probably benign Het
Ppfia3 T C 7: 45,341,743 N1018S probably benign Het
Prkd1 A G 12: 50,388,342 V534A possibly damaging Het
Pygm A T 19: 6,385,896 I126F probably benign Het
Rag1 T C 2: 101,642,070 Y909C probably damaging Het
Rasgrf2 G A 13: 91,884,518 Q560* probably null Het
Rbp3 A T 14: 33,962,583 I1190F possibly damaging Het
Reln T C 5: 21,978,923 K1693E probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rsph3a A G 17: 7,946,170 T121A probably benign Het
Rufy3 A G 5: 88,614,947 N112S possibly damaging Het
Ryr3 G A 2: 112,672,246 Q3548* probably null Het
Sardh A T 2: 27,218,812 V637D probably benign Het
Spata16 T C 3: 26,667,867 V179A probably benign Het
Tbc1d30 G A 10: 121,288,965 T319I probably damaging Het
Tlr2 T A 3: 83,837,606 Q390L possibly damaging Het
Tmem53 C T 4: 117,252,040 probably null Het
Vmn1r113 T A 7: 20,787,445 I54N probably damaging Het
Vmn1r223 A C 13: 23,249,866 Y210S probably damaging Het
Zbbx A T 3: 75,039,898 H670Q probably benign Het
Other mutations in Olfr1097
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Olfr1097 APN 2 86890245 missense probably benign
IGL01674:Olfr1097 APN 2 86890749 missense probably benign
IGL02089:Olfr1097 APN 2 86891116 missense possibly damaging 0.86
IGL02201:Olfr1097 APN 2 86891076 missense probably damaging 0.97
IGL02426:Olfr1097 APN 2 86890620 missense probably damaging 1.00
IGL02469:Olfr1097 APN 2 86891155 missense possibly damaging 0.91
IGL02489:Olfr1097 APN 2 86890995 missense probably damaging 1.00
IGL02817:Olfr1097 APN 2 86890593 missense probably benign
R0042:Olfr1097 UTSW 2 86890491 missense probably damaging 1.00
R0605:Olfr1097 UTSW 2 86890419 missense possibly damaging 0.65
R1867:Olfr1097 UTSW 2 86890612 missense probably damaging 0.98
R2412:Olfr1097 UTSW 2 86890834 missense probably benign 0.01
R4465:Olfr1097 UTSW 2 86891150 missense probably benign
R4520:Olfr1097 UTSW 2 86891019 missense probably benign 0.20
R5185:Olfr1097 UTSW 2 86890602 missense probably benign 0.42
R5329:Olfr1097 UTSW 2 86890620 missense probably damaging 1.00
R5496:Olfr1097 UTSW 2 86890314 missense probably damaging 1.00
R5496:Olfr1097 UTSW 2 86890315 missense probably damaging 1.00
R5847:Olfr1097 UTSW 2 86890332 missense probably damaging 0.99
R6288:Olfr1097 UTSW 2 86890882 missense probably benign 0.01
R6906:Olfr1097 UTSW 2 86890747 missense probably benign
R7161:Olfr1097 UTSW 2 86890649 missense probably benign 0.01
R7404:Olfr1097 UTSW 2 86890873 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACTCCTATAAGATGTGAGGCAC -3'
(R):5'- TTTCGTCAATGGCCTATGACCG -3'

Sequencing Primer
(F):5'- CACATGTAGAGAAGGCTTTGTGC -3'
(R):5'- AATGGCCTATGACCGCTATG -3'
Posted On2019-06-26