Incidental Mutation 'R7256:Ctcfl'
ID 564249
Institutional Source Beutler Lab
Gene Symbol Ctcfl
Ensembl Gene ENSMUSG00000070495
Gene Name CCCTC-binding factor (zinc finger protein)-like
Synonyms Boris, OTTMUSG00000016680
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock # R7256 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 173093609-173119525 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 173118475 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 105 (A105E)
Ref Sequence ENSEMBL: ENSMUSP00000091845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094287] [ENSMUST00000179693]
AlphaFold A2APF3
Predicted Effect probably benign
Transcript: ENSMUST00000094287
AA Change: A105E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000091845
Gene: ENSMUSG00000070495
AA Change: A105E

DomainStartEndE-ValueType
low complexity region 194 202 N/A INTRINSIC
ZnF_C2H2 257 279 1.79e-2 SMART
ZnF_C2H2 285 307 1.07e0 SMART
ZnF_C2H2 313 336 4.47e-3 SMART
ZnF_C2H2 342 364 1.79e-2 SMART
ZnF_C2H2 370 392 5.81e-2 SMART
ZnF_C2H2 398 421 1.36e-2 SMART
ZnF_C2H2 428 451 6.23e-2 SMART
ZnF_C2H2 458 480 1.89e-1 SMART
ZnF_C2H2 486 508 8.94e-3 SMART
ZnF_C2H2 514 537 2.32e-1 SMART
ZnF_C2H2 546 572 5.2e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179693
AA Change: A105E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000135932
Gene: ENSMUSG00000070495
AA Change: A105E

DomainStartEndE-ValueType
low complexity region 194 202 N/A INTRINSIC
ZnF_C2H2 257 279 1.79e-2 SMART
ZnF_C2H2 285 307 1.07e0 SMART
ZnF_C2H2 313 336 4.47e-3 SMART
ZnF_C2H2 342 364 1.79e-2 SMART
ZnF_C2H2 370 392 5.81e-2 SMART
ZnF_C2H2 398 421 1.36e-2 SMART
ZnF_C2H2 428 451 6.23e-2 SMART
ZnF_C2H2 458 480 1.89e-1 SMART
ZnF_C2H2 486 508 8.94e-3 SMART
ZnF_C2H2 514 537 2.32e-1 SMART
ZnF_C2H2 546 572 5.2e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CCCTC-binding factor (CTCF), an 11-zinc-finger factor involved in gene regulation, utilizes different zinc fingers to bind varying DNA target sites. CTCF forms methylation-sensitive insulators that regulate X-chromosome inactivation. This gene is a paralog of CTCF and appears to be expressed primarily in the cytoplasm of spermatocytes, unlike CTCF which is expressed primarily in the nucleus of somatic cells. CTCF and the protein encoded by this gene are normally expressed in a mutually exclusive pattern that correlates with resetting of methylation marks during male germ cell differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small testes, delayed spermatid development, and increased male germ cell apoptosis without affecting fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,863,035 Y790H probably damaging Het
Bend3 A C 10: 43,493,671 S7R probably benign Het
Ccdc106 A G 7: 5,060,326 T277A probably damaging Het
Ccdc162 G A 10: 41,556,001 A1832V probably damaging Het
Ccser1 A G 6: 61,311,867 E338G probably benign Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cecr2 T C 6: 120,762,529 S1406P probably benign Het
Cep290 A G 10: 100,546,498 T208A probably damaging Het
Cep85l A C 10: 53,296,255 C569W probably damaging Het
Ces5a G A 8: 93,499,526 T527I probably benign Het
Clca2 T A 3: 145,090,847 I200F probably damaging Het
Cmas G A 6: 142,770,586 D251N probably damaging Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
Dctn6 A T 8: 34,090,808 I170N probably damaging Het
Dnah2 T C 11: 69,431,094 Y3800C probably damaging Het
Dsg2 G A 18: 20,591,931 V465I possibly damaging Het
Dzip1 T C 14: 118,885,646 T646A probably benign Het
Etv4 T A 11: 101,784,325 probably null Het
Exoc3l2 T C 7: 19,484,703 V549A unknown Het
Ficd G T 5: 113,738,819 A352S probably damaging Het
Fry T G 5: 150,466,786 I179S Het
Galntl5 A G 5: 25,195,300 H109R probably benign Het
Garem1 C A 18: 21,148,754 G182W probably damaging Het
Gm10696 T C 3: 94,176,360 E48G probably benign Het
Gm13078 T A 4: 143,726,279 D93E probably benign Het
Gm5916 A T 9: 36,120,989 Y50N possibly damaging Het
Gtf2h2 A T 13: 100,479,201 F271I probably benign Het
Hivep2 G T 10: 14,129,101 S481I probably benign Het
Homez T A 14: 54,857,420 Q277L probably damaging Het
Hoxb4 C A 11: 96,319,896 probably null Het
Igll1 A G 16: 16,861,093 S118P probably damaging Het
Ikzf2 A C 1: 69,578,053 probably null Het
Kif5b A G 18: 6,225,340 V230A probably damaging Het
Ldlr T A 9: 21,745,744 V719E probably benign Het
Lsm7 G A 10: 80,853,731 R66W possibly damaging Het
Map3k13 T A 16: 21,892,238 D90E probably benign Het
Mmrn1 A G 6: 60,976,114 K460E probably damaging Het
Myh10 A C 11: 68,790,689 N1061H probably damaging Het
Nepn A G 10: 52,400,993 Q275R probably benign Het
Noc3l A T 19: 38,812,356 D227E probably benign Het
Nploc4 G T 11: 120,428,550 S61R probably benign Het
Nr4a2 T C 2: 57,112,369 Y24C probably damaging Het
Nup160 T A 2: 90,723,355 I1143N probably damaging Het
Olfr1097 A G 2: 86,890,612 S188P probably damaging Het
Olfr1234 A T 2: 89,362,494 Y312N probably benign Het
Olfr294 G T 7: 86,615,665 H327N probably benign Het
Olfr895 T A 9: 38,268,708 M57K probably damaging Het
Papola T A 12: 105,809,345 C204S probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pgap1 A T 1: 54,493,207 probably null Het
Pitrm1 A G 13: 6,556,597 H229R probably damaging Het
Plcl1 A G 1: 55,698,218 Q906R probably benign Het
Ppfia3 T C 7: 45,341,743 N1018S probably benign Het
Prkd1 A G 12: 50,388,342 V534A possibly damaging Het
Pygm A T 19: 6,385,896 I126F probably benign Het
Rag1 T C 2: 101,642,070 Y909C probably damaging Het
Rasgrf2 G A 13: 91,884,518 Q560* probably null Het
Rbp3 A T 14: 33,962,583 I1190F possibly damaging Het
Reln T C 5: 21,978,923 K1693E probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rsph3a A G 17: 7,946,170 T121A probably benign Het
Rufy3 A G 5: 88,614,947 N112S possibly damaging Het
Ryr3 G A 2: 112,672,246 Q3548* probably null Het
Sardh A T 2: 27,218,812 V637D probably benign Het
Spata16 T C 3: 26,667,867 V179A probably benign Het
Tbc1d30 G A 10: 121,288,965 T319I probably damaging Het
Tlr2 T A 3: 83,837,606 Q390L possibly damaging Het
Tmem53 C T 4: 117,252,040 probably null Het
Vmn1r113 T A 7: 20,787,445 I54N probably damaging Het
Vmn1r223 A C 13: 23,249,866 Y210S probably damaging Het
Zbbx A T 3: 75,039,898 H670Q probably benign Het
Other mutations in Ctcfl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Ctcfl APN 2 173094734 missense possibly damaging 0.82
IGL01418:Ctcfl APN 2 173118331 missense probably benign 0.03
IGL01524:Ctcfl APN 2 173117384 missense probably benign 0.08
IGL02610:Ctcfl APN 2 173106026 splice site probably benign
IGL02961:Ctcfl APN 2 173101919 missense possibly damaging 0.70
BB001:Ctcfl UTSW 2 173113656 missense possibly damaging 0.71
BB011:Ctcfl UTSW 2 173113656 missense possibly damaging 0.71
R0147:Ctcfl UTSW 2 173118547 missense possibly damaging 0.75
R0148:Ctcfl UTSW 2 173118547 missense possibly damaging 0.75
R0362:Ctcfl UTSW 2 173118443 missense probably damaging 0.99
R1099:Ctcfl UTSW 2 173112360 missense probably damaging 1.00
R1540:Ctcfl UTSW 2 173112348 missense probably benign 0.36
R1892:Ctcfl UTSW 2 173118685 missense probably benign 0.24
R2036:Ctcfl UTSW 2 173101985 missense possibly damaging 0.95
R2060:Ctcfl UTSW 2 173118506 missense probably benign 0.00
R2925:Ctcfl UTSW 2 173094696 missense probably damaging 1.00
R4327:Ctcfl UTSW 2 173113506 intron probably benign
R4837:Ctcfl UTSW 2 173113656 missense probably benign 0.00
R4894:Ctcfl UTSW 2 173117403 missense probably benign 0.19
R4909:Ctcfl UTSW 2 173095398 missense probably benign 0.42
R5128:Ctcfl UTSW 2 173117396 missense probably benign 0.00
R5247:Ctcfl UTSW 2 173113609 missense probably damaging 1.00
R6263:Ctcfl UTSW 2 173095337 missense probably benign 0.00
R6768:Ctcfl UTSW 2 173117291 missense possibly damaging 0.84
R7045:Ctcfl UTSW 2 173112374 missense probably damaging 1.00
R7180:Ctcfl UTSW 2 173105977 splice site probably null
R7268:Ctcfl UTSW 2 173107795 missense probably benign 0.26
R7378:Ctcfl UTSW 2 173112258 missense probably damaging 1.00
R7560:Ctcfl UTSW 2 173118406 missense probably damaging 0.96
R7657:Ctcfl UTSW 2 173113656 missense possibly damaging 0.71
R7733:Ctcfl UTSW 2 173117192 missense probably benign
R7924:Ctcfl UTSW 2 173113656 missense possibly damaging 0.71
R7945:Ctcfl UTSW 2 173118658 missense probably benign
R8022:Ctcfl UTSW 2 173118766 missense probably benign 0.15
R8038:Ctcfl UTSW 2 173101905 missense probably damaging 1.00
R8911:Ctcfl UTSW 2 173095328 critical splice donor site probably null
R9031:Ctcfl UTSW 2 173117251 missense probably benign 0.07
R9358:Ctcfl UTSW 2 173118788 start codon destroyed possibly damaging 0.81
R9401:Ctcfl UTSW 2 173106088 missense probably damaging 0.99
R9490:Ctcfl UTSW 2 173118755 missense probably benign 0.00
Z1088:Ctcfl UTSW 2 173118344 missense probably benign 0.01
Z1177:Ctcfl UTSW 2 173102036 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGTGCTTTCGTCCAAGTC -3'
(R):5'- TGAAGCCTGGAGACCTAGAG -3'

Sequencing Primer
(F):5'- TCGTCCAAGTCTGGTGTTAAC -3'
(R):5'- TTGTCAAGGAGGTGGAGGCC -3'
Posted On 2019-06-26