Incidental Mutation 'R7256:Ccdc162'
ID 564278
Institutional Source Beutler Lab
Gene Symbol Ccdc162
Ensembl Gene ENSMUSG00000075225
Gene Name coiled-coil domain containing 162
Synonyms Gm29096, Gm6976, 5033413D22Rik
MMRRC Submission 045317-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R7256 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 41414838-41592586 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 41431997 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 1832 (A1832V)
Ref Sequence ENSEMBL: ENSMUSP00000140774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019955] [ENSMUST00000099932] [ENSMUST00000179614] [ENSMUST00000189488] [ENSMUST00000219054]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000019955
AA Change: A40V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019955
Gene: ENSMUSG00000075225
AA Change: A40V

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
low complexity region 116 138 N/A INTRINSIC
coiled coil region 177 217 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000092852
Gene: ENSMUSG00000075225
AA Change: A182V

DomainStartEndE-ValueType
coiled coil region 140 179 N/A INTRINSIC
low complexity region 304 326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099932
AA Change: A369V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097516
Gene: ENSMUSG00000075225
AA Change: A369V

DomainStartEndE-ValueType
coiled coil region 327 366 N/A INTRINSIC
low complexity region 490 512 N/A INTRINSIC
coiled coil region 551 607 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179614
AA Change: A559V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135966
Gene: ENSMUSG00000075225
AA Change: A559V

DomainStartEndE-ValueType
coiled coil region 517 556 N/A INTRINSIC
low complexity region 680 702 N/A INTRINSIC
coiled coil region 741 797 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189488
AA Change: A1832V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140774
Gene: ENSMUSG00000075225
AA Change: A1832V

DomainStartEndE-ValueType
low complexity region 328 347 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219054
AA Change: A559V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,659,923 (GRCm39) Y790H probably damaging Het
Bend3 A C 10: 43,369,667 (GRCm39) S7R probably benign Het
Ccdc106 A G 7: 5,063,325 (GRCm39) T277A probably damaging Het
Ccser1 A G 6: 61,288,851 (GRCm39) E338G probably benign Het
Cd86 CA CAA 16: 36,426,917 (GRCm39) probably null Het
Cecr2 T C 6: 120,739,490 (GRCm39) S1406P probably benign Het
Cep290 A G 10: 100,382,360 (GRCm39) T208A probably damaging Het
Cep85l A C 10: 53,172,351 (GRCm39) C569W probably damaging Het
Ces5a G A 8: 94,226,154 (GRCm39) T527I probably benign Het
Clca3a2 T A 3: 144,796,608 (GRCm39) I200F probably damaging Het
Cmas G A 6: 142,716,312 (GRCm39) D251N probably damaging Het
Ctcfl G T 2: 172,960,268 (GRCm39) A105E probably benign Het
Dclk2 C T 3: 86,700,566 (GRCm39) R638H probably damaging Het
Dctn6 A T 8: 34,557,962 (GRCm39) I170N probably damaging Het
Dnah2 T C 11: 69,321,920 (GRCm39) Y3800C probably damaging Het
Dsg2 G A 18: 20,724,988 (GRCm39) V465I possibly damaging Het
Dzip1 T C 14: 119,123,058 (GRCm39) T646A probably benign Het
Etv4 T A 11: 101,675,151 (GRCm39) probably null Het
Exoc3l2 T C 7: 19,218,628 (GRCm39) V549A unknown Het
Ficd G T 5: 113,876,880 (GRCm39) A352S probably damaging Het
Fry T G 5: 150,390,251 (GRCm39) I179S Het
Galntl5 A G 5: 25,400,298 (GRCm39) H109R probably benign Het
Garem1 C A 18: 21,281,811 (GRCm39) G182W probably damaging Het
Gm5916 A T 9: 36,032,285 (GRCm39) Y50N possibly damaging Het
Gtf2h2 A T 13: 100,615,709 (GRCm39) F271I probably benign Het
Hivep2 G T 10: 14,004,845 (GRCm39) S481I probably benign Het
Homez T A 14: 55,094,877 (GRCm39) Q277L probably damaging Het
Hoxb4 C A 11: 96,210,722 (GRCm39) probably null Het
Igll1 A G 16: 16,678,957 (GRCm39) S118P probably damaging Het
Ikzf2 A C 1: 69,617,212 (GRCm39) probably null Het
Kif5b A G 18: 6,225,340 (GRCm39) V230A probably damaging Het
Ldlr T A 9: 21,657,040 (GRCm39) V719E probably benign Het
Lsm7 G A 10: 80,689,565 (GRCm39) R66W possibly damaging Het
Map3k13 T A 16: 21,710,988 (GRCm39) D90E probably benign Het
Mmrn1 A G 6: 60,953,098 (GRCm39) K460E probably damaging Het
Myh10 A C 11: 68,681,515 (GRCm39) N1061H probably damaging Het
Nepn A G 10: 52,277,089 (GRCm39) Q275R probably benign Het
Noc3l A T 19: 38,800,800 (GRCm39) D227E probably benign Het
Nploc4 G T 11: 120,319,376 (GRCm39) S61R probably benign Het
Nr4a2 T C 2: 57,002,381 (GRCm39) Y24C probably damaging Het
Nup160 T A 2: 90,553,699 (GRCm39) I1143N probably damaging Het
Or14a256 G T 7: 86,264,873 (GRCm39) H327N probably benign Het
Or4a15 A T 2: 89,192,838 (GRCm39) Y312N probably benign Het
Or8c17 T A 9: 38,180,004 (GRCm39) M57K probably damaging Het
Or8h7 A G 2: 86,720,956 (GRCm39) S188P probably damaging Het
Papola T A 12: 105,775,604 (GRCm39) C204S probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pgap1 A T 1: 54,532,366 (GRCm39) probably null Het
Pitrm1 A G 13: 6,606,633 (GRCm39) H229R probably damaging Het
Plcl1 A G 1: 55,737,377 (GRCm39) Q906R probably benign Het
Ppfia3 T C 7: 44,991,167 (GRCm39) N1018S probably benign Het
Pramel24 T A 4: 143,452,849 (GRCm39) D93E probably benign Het
Prkd1 A G 12: 50,435,125 (GRCm39) V534A possibly damaging Het
Pygm A T 19: 6,435,926 (GRCm39) I126F probably benign Het
Rag1 T C 2: 101,472,415 (GRCm39) Y909C probably damaging Het
Rasgrf2 G A 13: 92,032,637 (GRCm39) Q560* probably null Het
Rbp3 A T 14: 33,684,540 (GRCm39) I1190F possibly damaging Het
Reln T C 5: 22,183,921 (GRCm39) K1693E probably benign Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Rsph3a A G 17: 8,165,002 (GRCm39) T121A probably benign Het
Rufy3 A G 5: 88,762,806 (GRCm39) N112S possibly damaging Het
Ryr3 G A 2: 112,502,591 (GRCm39) Q3548* probably null Het
Sardh A T 2: 27,108,824 (GRCm39) V637D probably benign Het
Spata16 T C 3: 26,722,016 (GRCm39) V179A probably benign Het
Spopfm2 T C 3: 94,083,667 (GRCm39) E48G probably benign Het
Tbc1d30 G A 10: 121,124,870 (GRCm39) T319I probably damaging Het
Tlr2 T A 3: 83,744,913 (GRCm39) Q390L possibly damaging Het
Tmem53 C T 4: 117,109,237 (GRCm39) probably null Het
Vmn1r113 T A 7: 20,521,370 (GRCm39) I54N probably damaging Het
Vmn1r223 A C 13: 23,434,036 (GRCm39) Y210S probably damaging Het
Zbbx A T 3: 74,947,205 (GRCm39) H670Q probably benign Het
Other mutations in Ccdc162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Ccdc162 APN 10 41,457,335 (GRCm39) missense probably benign 0.01
IGL01366:Ccdc162 APN 10 41,456,302 (GRCm39) missense possibly damaging 0.49
IGL01924:Ccdc162 APN 10 41,445,883 (GRCm39) missense probably damaging 1.00
IGL02504:Ccdc162 APN 10 41,428,384 (GRCm39) missense probably damaging 1.00
IGL02678:Ccdc162 APN 10 41,437,151 (GRCm39) missense probably damaging 0.99
IGL02955:Ccdc162 APN 10 41,437,123 (GRCm39) missense probably damaging 1.00
beeswax UTSW 10 41,437,222 (GRCm39) missense possibly damaging 0.57
honeycomb UTSW 10 41,520,637 (GRCm39) missense probably benign 0.35
FR4304:Ccdc162 UTSW 10 41,432,117 (GRCm39) missense possibly damaging 0.49
R0432:Ccdc162 UTSW 10 41,417,856 (GRCm39) missense probably benign 0.01
R0585:Ccdc162 UTSW 10 41,462,375 (GRCm39) missense probably benign 0.03
R0645:Ccdc162 UTSW 10 41,462,407 (GRCm39) splice site probably benign
R0731:Ccdc162 UTSW 10 41,455,139 (GRCm39) missense probably damaging 1.00
R1426:Ccdc162 UTSW 10 41,429,178 (GRCm39) missense possibly damaging 0.89
R1447:Ccdc162 UTSW 10 41,456,243 (GRCm39) missense probably damaging 1.00
R1712:Ccdc162 UTSW 10 41,415,427 (GRCm39) missense probably benign 0.35
R2138:Ccdc162 UTSW 10 41,457,293 (GRCm39) missense probably benign 0.15
R2351:Ccdc162 UTSW 10 41,431,968 (GRCm39) critical splice donor site probably null
R2394:Ccdc162 UTSW 10 41,445,894 (GRCm39) missense probably damaging 1.00
R2431:Ccdc162 UTSW 10 41,445,841 (GRCm39) missense probably benign
R2571:Ccdc162 UTSW 10 41,428,393 (GRCm39) missense probably damaging 1.00
R2873:Ccdc162 UTSW 10 41,531,095 (GRCm39) missense possibly damaging 0.68
R2926:Ccdc162 UTSW 10 41,437,203 (GRCm39) start gained probably benign
R2999:Ccdc162 UTSW 10 41,456,286 (GRCm39) missense probably benign 0.00
R3412:Ccdc162 UTSW 10 41,415,545 (GRCm39) splice site probably benign
R3712:Ccdc162 UTSW 10 41,463,375 (GRCm39) missense probably benign
R3736:Ccdc162 UTSW 10 41,465,564 (GRCm39) splice site probably null
R4112:Ccdc162 UTSW 10 41,532,324 (GRCm39) missense possibly damaging 0.77
R4557:Ccdc162 UTSW 10 41,463,384 (GRCm39) missense probably benign 0.01
R4580:Ccdc162 UTSW 10 41,437,136 (GRCm39) missense probably benign 0.02
R4685:Ccdc162 UTSW 10 41,557,682 (GRCm39) missense possibly damaging 0.89
R4837:Ccdc162 UTSW 10 41,549,863 (GRCm39) missense probably benign 0.00
R5155:Ccdc162 UTSW 10 41,455,147 (GRCm39) missense probably damaging 1.00
R5155:Ccdc162 UTSW 10 41,429,576 (GRCm39) splice site probably null
R5645:Ccdc162 UTSW 10 41,428,352 (GRCm39) missense probably benign 0.06
R5656:Ccdc162 UTSW 10 41,445,930 (GRCm39) missense probably benign 0.26
R5682:Ccdc162 UTSW 10 41,432,799 (GRCm39) nonsense probably null
R5808:Ccdc162 UTSW 10 41,531,500 (GRCm39) missense possibly damaging 0.62
R5909:Ccdc162 UTSW 10 41,437,111 (GRCm39) missense probably damaging 1.00
R6000:Ccdc162 UTSW 10 41,437,159 (GRCm39) missense possibly damaging 0.75
R6057:Ccdc162 UTSW 10 41,510,037 (GRCm39) missense possibly damaging 0.72
R6211:Ccdc162 UTSW 10 41,506,141 (GRCm39) nonsense probably null
R6264:Ccdc162 UTSW 10 41,570,464 (GRCm39) missense probably benign 0.31
R6329:Ccdc162 UTSW 10 41,539,147 (GRCm39) missense possibly damaging 0.76
R6349:Ccdc162 UTSW 10 41,570,396 (GRCm39) missense probably damaging 0.97
R6398:Ccdc162 UTSW 10 41,503,145 (GRCm39) missense probably damaging 1.00
R6453:Ccdc162 UTSW 10 41,426,821 (GRCm39) missense probably damaging 1.00
R6602:Ccdc162 UTSW 10 41,491,976 (GRCm39) missense probably benign 0.00
R6627:Ccdc162 UTSW 10 41,539,181 (GRCm39) missense probably damaging 1.00
R6722:Ccdc162 UTSW 10 41,520,637 (GRCm39) missense probably benign 0.35
R6750:Ccdc162 UTSW 10 41,437,222 (GRCm39) missense possibly damaging 0.57
R6968:Ccdc162 UTSW 10 41,549,840 (GRCm39) missense possibly damaging 0.55
R6970:Ccdc162 UTSW 10 41,491,954 (GRCm39) missense probably benign 0.03
R6989:Ccdc162 UTSW 10 41,457,349 (GRCm39) missense probably damaging 0.99
R7008:Ccdc162 UTSW 10 41,428,411 (GRCm39) missense probably damaging 1.00
R7135:Ccdc162 UTSW 10 41,549,855 (GRCm39) missense probably benign 0.00
R7139:Ccdc162 UTSW 10 41,542,717 (GRCm39) missense possibly damaging 0.49
R7224:Ccdc162 UTSW 10 41,437,187 (GRCm39) missense probably damaging 1.00
R7230:Ccdc162 UTSW 10 41,554,809 (GRCm39) missense probably damaging 1.00
R7261:Ccdc162 UTSW 10 41,437,136 (GRCm39) missense probably benign 0.02
R7390:Ccdc162 UTSW 10 41,510,044 (GRCm39) missense probably benign
R7712:Ccdc162 UTSW 10 41,503,223 (GRCm39) missense possibly damaging 0.56
R7726:Ccdc162 UTSW 10 41,429,071 (GRCm39) missense probably benign 0.00
R7754:Ccdc162 UTSW 10 41,463,371 (GRCm39) missense probably damaging 1.00
R7764:Ccdc162 UTSW 10 41,566,109 (GRCm39) missense possibly damaging 0.95
R8053:Ccdc162 UTSW 10 41,520,577 (GRCm39) missense probably benign
R8088:Ccdc162 UTSW 10 41,499,410 (GRCm39) missense possibly damaging 0.68
R8094:Ccdc162 UTSW 10 41,488,864 (GRCm39) missense probably benign 0.02
R8097:Ccdc162 UTSW 10 41,510,115 (GRCm39) missense probably benign 0.03
R8321:Ccdc162 UTSW 10 41,510,029 (GRCm39) missense probably damaging 0.98
R8377:Ccdc162 UTSW 10 41,457,306 (GRCm39) missense probably benign 0.08
R8399:Ccdc162 UTSW 10 41,415,517 (GRCm39) missense probably damaging 1.00
R8669:Ccdc162 UTSW 10 41,428,352 (GRCm39) missense probably benign 0.06
R8772:Ccdc162 UTSW 10 41,506,033 (GRCm39) missense probably damaging 0.99
R8810:Ccdc162 UTSW 10 41,542,737 (GRCm39) missense probably benign 0.41
R8903:Ccdc162 UTSW 10 41,531,440 (GRCm39) critical splice donor site probably null
R8928:Ccdc162 UTSW 10 41,462,245 (GRCm39) splice site probably benign
R8950:Ccdc162 UTSW 10 41,474,507 (GRCm39) missense probably benign 0.00
R8960:Ccdc162 UTSW 10 41,429,178 (GRCm39) missense probably damaging 0.96
R8985:Ccdc162 UTSW 10 41,432,102 (GRCm39) missense probably damaging 1.00
R9071:Ccdc162 UTSW 10 41,457,174 (GRCm39) nonsense probably null
R9254:Ccdc162 UTSW 10 41,488,944 (GRCm39) critical splice acceptor site probably null
R9297:Ccdc162 UTSW 10 41,506,110 (GRCm39) missense probably benign
R9318:Ccdc162 UTSW 10 41,506,110 (GRCm39) missense probably benign
R9518:Ccdc162 UTSW 10 41,465,572 (GRCm39) missense probably damaging 1.00
R9525:Ccdc162 UTSW 10 41,559,222 (GRCm39) missense probably damaging 0.99
R9539:Ccdc162 UTSW 10 41,463,407 (GRCm39) missense possibly damaging 0.54
R9638:Ccdc162 UTSW 10 41,437,159 (GRCm39) missense probably benign 0.01
Z1176:Ccdc162 UTSW 10 41,530,993 (GRCm39) missense possibly damaging 0.84
Z1176:Ccdc162 UTSW 10 41,481,104 (GRCm39) missense possibly damaging 0.84
Z1176:Ccdc162 UTSW 10 41,429,127 (GRCm39) missense probably benign 0.00
Z1176:Ccdc162 UTSW 10 41,566,088 (GRCm39) missense probably benign 0.00
Z1177:Ccdc162 UTSW 10 41,559,191 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATGATTCTCTCTGTGGCAAATC -3'
(R):5'- AATCACTGCATTGCCAGCC -3'

Sequencing Primer
(F):5'- AGTGGCGCATGTCTATAATCCCAG -3'
(R):5'- GCCTCCCCTCATGGCATATATTCTG -3'
Posted On 2019-06-26