Incidental Mutation 'R7256:Tbc1d30'
ID 564284
Institutional Source Beutler Lab
Gene Symbol Tbc1d30
Ensembl Gene ENSMUSG00000052302
Gene Name TBC1 domain family, member 30
Synonyms 4930505D03Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7256 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 121263820-121351278 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 121288965 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 319 (T319I)
Ref Sequence ENSEMBL: ENSMUSP00000070488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064107]
AlphaFold Q69ZT9
Predicted Effect probably damaging
Transcript: ENSMUST00000064107
AA Change: T319I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070488
Gene: ENSMUSG00000052302
AA Change: T319I

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
TBC 84 318 2.22e-30 SMART
low complexity region 392 403 N/A INTRINSIC
Pfam:DUF4682 475 613 4.3e-50 PFAM
low complexity region 623 633 N/A INTRINSIC
low complexity region 649 657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218111
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,863,035 Y790H probably damaging Het
Bend3 A C 10: 43,493,671 S7R probably benign Het
Ccdc106 A G 7: 5,060,326 T277A probably damaging Het
Ccdc162 G A 10: 41,556,001 A1832V probably damaging Het
Ccser1 A G 6: 61,311,867 E338G probably benign Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cecr2 T C 6: 120,762,529 S1406P probably benign Het
Cep290 A G 10: 100,546,498 T208A probably damaging Het
Cep85l A C 10: 53,296,255 C569W probably damaging Het
Ces5a G A 8: 93,499,526 T527I probably benign Het
Clca2 T A 3: 145,090,847 I200F probably damaging Het
Cmas G A 6: 142,770,586 D251N probably damaging Het
Ctcfl G T 2: 173,118,475 A105E probably benign Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
Dctn6 A T 8: 34,090,808 I170N probably damaging Het
Dnah2 T C 11: 69,431,094 Y3800C probably damaging Het
Dsg2 G A 18: 20,591,931 V465I possibly damaging Het
Dzip1 T C 14: 118,885,646 T646A probably benign Het
Etv4 T A 11: 101,784,325 probably null Het
Exoc3l2 T C 7: 19,484,703 V549A unknown Het
Ficd G T 5: 113,738,819 A352S probably damaging Het
Fry T G 5: 150,466,786 I179S Het
Galntl5 A G 5: 25,195,300 H109R probably benign Het
Garem1 C A 18: 21,148,754 G182W probably damaging Het
Gm10696 T C 3: 94,176,360 E48G probably benign Het
Gm13078 T A 4: 143,726,279 D93E probably benign Het
Gm5916 A T 9: 36,120,989 Y50N possibly damaging Het
Gtf2h2 A T 13: 100,479,201 F271I probably benign Het
Hivep2 G T 10: 14,129,101 S481I probably benign Het
Homez T A 14: 54,857,420 Q277L probably damaging Het
Hoxb4 C A 11: 96,319,896 probably null Het
Igll1 A G 16: 16,861,093 S118P probably damaging Het
Ikzf2 A C 1: 69,578,053 probably null Het
Kif5b A G 18: 6,225,340 V230A probably damaging Het
Ldlr T A 9: 21,745,744 V719E probably benign Het
Lsm7 G A 10: 80,853,731 R66W possibly damaging Het
Map3k13 T A 16: 21,892,238 D90E probably benign Het
Mmrn1 A G 6: 60,976,114 K460E probably damaging Het
Myh10 A C 11: 68,790,689 N1061H probably damaging Het
Nepn A G 10: 52,400,993 Q275R probably benign Het
Noc3l A T 19: 38,812,356 D227E probably benign Het
Nploc4 G T 11: 120,428,550 S61R probably benign Het
Nr4a2 T C 2: 57,112,369 Y24C probably damaging Het
Nup160 T A 2: 90,723,355 I1143N probably damaging Het
Olfr1097 A G 2: 86,890,612 S188P probably damaging Het
Olfr1234 A T 2: 89,362,494 Y312N probably benign Het
Olfr294 G T 7: 86,615,665 H327N probably benign Het
Olfr895 T A 9: 38,268,708 M57K probably damaging Het
Papola T A 12: 105,809,345 C204S probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pgap1 A T 1: 54,493,207 probably null Het
Pitrm1 A G 13: 6,556,597 H229R probably damaging Het
Plcl1 A G 1: 55,698,218 Q906R probably benign Het
Ppfia3 T C 7: 45,341,743 N1018S probably benign Het
Prkd1 A G 12: 50,388,342 V534A possibly damaging Het
Pygm A T 19: 6,385,896 I126F probably benign Het
Rag1 T C 2: 101,642,070 Y909C probably damaging Het
Rasgrf2 G A 13: 91,884,518 Q560* probably null Het
Rbp3 A T 14: 33,962,583 I1190F possibly damaging Het
Reln T C 5: 21,978,923 K1693E probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rsph3a A G 17: 7,946,170 T121A probably benign Het
Rufy3 A G 5: 88,614,947 N112S possibly damaging Het
Ryr3 G A 2: 112,672,246 Q3548* probably null Het
Sardh A T 2: 27,218,812 V637D probably benign Het
Spata16 T C 3: 26,667,867 V179A probably benign Het
Tlr2 T A 3: 83,837,606 Q390L possibly damaging Het
Tmem53 C T 4: 117,252,040 probably null Het
Vmn1r113 T A 7: 20,787,445 I54N probably damaging Het
Vmn1r223 A C 13: 23,249,866 Y210S probably damaging Het
Zbbx A T 3: 75,039,898 H670Q probably benign Het
Other mutations in Tbc1d30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Tbc1d30 APN 10 121266824 utr 3 prime probably benign
IGL00837:Tbc1d30 APN 10 121296845 missense probably damaging 1.00
IGL01081:Tbc1d30 APN 10 121267414 missense probably damaging 1.00
IGL01813:Tbc1d30 APN 10 121267051 missense probably benign
IGL01844:Tbc1d30 APN 10 121267179 missense probably benign 0.01
R1782:Tbc1d30 UTSW 10 121267620 missense probably damaging 1.00
R1972:Tbc1d30 UTSW 10 121306230 splice site probably null
R2025:Tbc1d30 UTSW 10 121279146 missense probably benign 0.18
R2197:Tbc1d30 UTSW 10 121304407 missense probably damaging 1.00
R3752:Tbc1d30 UTSW 10 121272168 missense probably damaging 1.00
R4374:Tbc1d30 UTSW 10 121294712 missense probably damaging 1.00
R4540:Tbc1d30 UTSW 10 121279158 missense probably damaging 0.99
R4624:Tbc1d30 UTSW 10 121296786 missense probably damaging 0.99
R4960:Tbc1d30 UTSW 10 121267216 missense probably benign 0.04
R5170:Tbc1d30 UTSW 10 121306838 missense possibly damaging 0.49
R5566:Tbc1d30 UTSW 10 121302110 missense probably damaging 1.00
R5642:Tbc1d30 UTSW 10 121296787 missense probably damaging 1.00
R5726:Tbc1d30 UTSW 10 121267574 missense probably damaging 1.00
R6051:Tbc1d30 UTSW 10 121296845 missense probably damaging 1.00
R6364:Tbc1d30 UTSW 10 121294725 missense possibly damaging 0.95
R7106:Tbc1d30 UTSW 10 121301992 missense possibly damaging 0.94
R7233:Tbc1d30 UTSW 10 121272057 missense probably benign 0.35
R7826:Tbc1d30 UTSW 10 121296805 missense probably damaging 1.00
R7910:Tbc1d30 UTSW 10 121347156 nonsense probably null
R7958:Tbc1d30 UTSW 10 121272057 missense probably benign 0.35
R7978:Tbc1d30 UTSW 10 121306199 missense probably damaging 1.00
R8021:Tbc1d30 UTSW 10 121267543 missense probably benign 0.09
R8394:Tbc1d30 UTSW 10 121347108 nonsense probably null
R8472:Tbc1d30 UTSW 10 121351104 missense probably benign 0.00
R8532:Tbc1d30 UTSW 10 121267430 missense probably damaging 1.00
R8887:Tbc1d30 UTSW 10 121351154 missense possibly damaging 0.45
R9124:Tbc1d30 UTSW 10 121296811 missense probably damaging 0.99
R9186:Tbc1d30 UTSW 10 121275734 missense probably benign
R9282:Tbc1d30 UTSW 10 121306223 critical splice acceptor site probably null
R9342:Tbc1d30 UTSW 10 121267461 nonsense probably null
R9531:Tbc1d30 UTSW 10 121347200 missense probably damaging 1.00
R9665:Tbc1d30 UTSW 10 121266981 missense possibly damaging 0.83
R9799:Tbc1d30 UTSW 10 121306169 missense possibly damaging 0.55
R9803:Tbc1d30 UTSW 10 121272075 missense probably damaging 1.00
Z1176:Tbc1d30 UTSW 10 121302113 missense probably damaging 1.00
Z1177:Tbc1d30 UTSW 10 121351064 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATAGACTCTTGGCCAGTGGAAAAG -3'
(R):5'- ACCTTGCCCTTGGTAATTTTGG -3'

Sequencing Primer
(F):5'- AGGACTGGCTGATACGGTTCC -3'
(R):5'- GTAATTTTGGTCTTTGCTCCACAG -3'
Posted On 2019-06-26