Incidental Mutation 'R0581:Lats1'
ID56429
Institutional Source Beutler Lab
Gene Symbol Lats1
Ensembl Gene ENSMUSG00000040021
Gene Namelarge tumor suppressor
Synonyms
MMRRC Submission 038771-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.869) question?
Stock #R0581 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location7681214-7716460 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7702941 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 610 (T610A)
Ref Sequence ENSEMBL: ENSMUSP00000151533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040043
AA Change: T610A

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: T610A

DomainStartEndE-ValueType
Pfam:UBA 101 138 7.4e-11 PFAM
low complexity region 228 267 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
low complexity region 371 379 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 554 559 N/A INTRINSIC
S_TKc 704 1009 7.3e-99 SMART
S_TK_X 1010 1081 1.2e-2 SMART
low complexity region 1102 1120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165952
AA Change: T610A

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: T610A

DomainStartEndE-ValueType
Pfam:UBA 101 138 7.4e-11 PFAM
low complexity region 228 267 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
low complexity region 371 379 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 554 559 N/A INTRINSIC
S_TKc 704 1009 7.3e-99 SMART
S_TK_X 1010 1081 1.2e-2 SMART
low complexity region 1102 1120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000217931
AA Change: T610A

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
Meta Mutation Damage Score 0.0697 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.3%
  • 20x: 93.7%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 4,050,620 T2761A probably benign Het
Apold1 G A 6: 134,983,813 V77I probably benign Het
Atad2 T C 15: 58,126,664 T139A probably benign Het
Cacna1a A T 8: 84,601,936 I1668F possibly damaging Het
Ccer2 T A 7: 28,757,026 probably benign Het
Cyp2c54 T A 19: 40,047,555 T304S probably benign Het
Dpp4 T A 2: 62,356,676 M497L probably benign Het
Evpl T A 11: 116,229,490 I541L probably benign Het
Ggn A G 7: 29,172,304 T370A probably benign Het
Ghr A G 15: 3,388,634 probably benign Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Gpr68 G C 12: 100,878,556 P243R probably damaging Het
Gtf3c2 G T 5: 31,159,518 Y720* probably null Het
Il2rb T A 15: 78,481,936 Y387F possibly damaging Het
Kcnu1 T A 8: 25,937,501 V282E probably damaging Het
Krt222 G A 11: 99,236,192 Q201* probably null Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Myh7 T C 14: 54,985,496 I751V probably benign Het
Mypn A G 10: 63,162,244 I429T probably benign Het
Nemf A T 12: 69,322,271 D723E probably benign Het
Nlrp4b T C 7: 10,714,530 L220P probably damaging Het
Npr3 T A 15: 11,851,450 D418V probably damaging Het
Nsd3 A G 8: 25,710,691 N1270S probably damaging Het
Olfr123 A G 17: 37,796,102 I219M probably damaging Het
Olfr344 T C 2: 36,568,822 S75P probably damaging Het
Otogl G A 10: 107,789,040 T1579I possibly damaging Het
Pkp2 T A 16: 16,269,783 probably benign Het
Psd3 T C 8: 67,720,946 Y301C probably damaging Het
Psmb4 T C 3: 94,886,168 H134R probably damaging Het
Ralgapb A G 2: 158,492,961 T1043A probably benign Het
Sec14l5 T A 16: 5,178,485 probably null Het
Serpina12 T A 12: 104,031,140 Q374L probably damaging Het
Serpinb10 C T 1: 107,546,962 R362* probably null Het
Sorcs1 T A 19: 50,252,701 I416F possibly damaging Het
Sparcl1 T C 5: 104,093,312 D82G probably damaging Het
Stat6 A T 10: 127,648,116 Q89L probably damaging Het
Tat A G 8: 109,991,638 T52A possibly damaging Het
Yipf7 T A 5: 69,521,063 I128F probably benign Het
Zfp112 T A 7: 24,125,863 C419S probably damaging Het
Zzef1 A G 11: 72,851,900 I769V probably benign Het
Other mutations in Lats1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Lats1 APN 10 7691566 missense probably damaging 0.99
IGL00595:Lats1 APN 10 7702305 missense probably benign 0.00
IGL00932:Lats1 APN 10 7712742 missense possibly damaging 0.69
IGL01019:Lats1 APN 10 7705671 missense probably damaging 1.00
IGL01380:Lats1 APN 10 7691780 missense possibly damaging 0.69
IGL01965:Lats1 APN 10 7701706 missense probably benign 0.10
IGL02027:Lats1 APN 10 7712948 missense probably benign
IGL02611:Lats1 APN 10 7705787 missense possibly damaging 0.91
IGL02997:Lats1 APN 10 7702254 missense possibly damaging 0.53
IGL03107:Lats1 APN 10 7712746 missense probably benign 0.15
I1329:Lats1 UTSW 10 7712802 missense probably benign 0.10
PIT4378001:Lats1 UTSW 10 7705605 missense probably damaging 1.00
R0153:Lats1 UTSW 10 7691575 missense probably damaging 1.00
R0568:Lats1 UTSW 10 7712528 missense possibly damaging 0.69
R0604:Lats1 UTSW 10 7712661 missense probably damaging 0.96
R1681:Lats1 UTSW 10 7705914 missense probably damaging 0.99
R1694:Lats1 UTSW 10 7701945 missense probably benign 0.07
R1840:Lats1 UTSW 10 7710939 nonsense probably null
R1914:Lats1 UTSW 10 7710457 splice site probably benign
R2137:Lats1 UTSW 10 7701847 missense possibly damaging 0.71
R2317:Lats1 UTSW 10 7691776 nonsense probably null
R3863:Lats1 UTSW 10 7705746 missense probably damaging 1.00
R3864:Lats1 UTSW 10 7705746 missense probably damaging 1.00
R4597:Lats1 UTSW 10 7691746 missense probably benign 0.00
R4657:Lats1 UTSW 10 7705684 missense possibly damaging 0.82
R4658:Lats1 UTSW 10 7702729 missense probably benign
R4663:Lats1 UTSW 10 7712583 missense probably damaging 1.00
R4870:Lats1 UTSW 10 7705785 missense probably damaging 1.00
R5101:Lats1 UTSW 10 7712584 nonsense probably null
R5134:Lats1 UTSW 10 7691811 missense probably benign 0.34
R5150:Lats1 UTSW 10 7712651 missense probably benign
R5546:Lats1 UTSW 10 7705754 missense probably damaging 0.99
R5820:Lats1 UTSW 10 7705908 missense probably damaging 1.00
R6006:Lats1 UTSW 10 7705595 missense probably damaging 1.00
R6301:Lats1 UTSW 10 7703107 missense probably benign 0.01
R6544:Lats1 UTSW 10 7701670 missense possibly damaging 0.94
R6647:Lats1 UTSW 10 7697507 missense possibly damaging 0.81
R6874:Lats1 UTSW 10 7710851 missense probably damaging 1.00
R7328:Lats1 UTSW 10 7705547 missense possibly damaging 0.62
R7390:Lats1 UTSW 10 7702095 nonsense probably null
R7438:Lats1 UTSW 10 7712942 nonsense probably null
R7457:Lats1 UTSW 10 7710891 missense probably damaging 1.00
R7524:Lats1 UTSW 10 7701978 missense possibly damaging 0.89
R7593:Lats1 UTSW 10 7701712 missense probably damaging 1.00
R7736:Lats1 UTSW 10 7702364 missense probably damaging 1.00
RF021:Lats1 UTSW 10 7710608 missense probably damaging 1.00
X0026:Lats1 UTSW 10 7710623 missense probably damaging 1.00
X0053:Lats1 UTSW 10 7691609 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTCAGACTGTTCAGCCTACCCC -3'
(R):5'- ATGCAGACGCTGCTGATGAGAC -3'

Sequencing Primer
(F):5'- ACCTGTTGCTGAAGCTCCAAG -3'
(R):5'- CTGCTGATGAGACTTCAGGAC -3'
Posted On2013-07-11