Mutagenetix > Incidental Mutations

Incidental Mutation 'R0581:Lats1'

56429

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

MMRRC Submission

038771-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.798) question?

Stock #

R0581 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 7702941 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 610 (T610A)

Ref Sequence

ENSEMBL: ENSMUSP00000151533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040043
AA Change: T610A

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: T610A

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000165952
AA Change: T610A

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: T610A

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217931
AA Change: T610A

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)

Meta Mutation Damage Score

0.0697

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.3%
20x: 93.7%

Validation Efficiency

95% (42/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap9	A	G	5: 4,050,620	T2761A	probably benign	Het
Apold1	G	A	6: 134,983,813	V77I	probably benign	Het
Atad2	T	C	15: 58,126,664	T139A	probably benign	Het
Cacna1a	A	T	8: 84,601,936	I1668F	possibly damaging	Het
Ccer2	T	A	7: 28,757,026		probably benign	Het
Cyp2c54	T	A	19: 40,047,555	T304S	probably benign	Het
Dpp4	T	A	2: 62,356,676	M497L	probably benign	Het
Evpl	T	A	11: 116,229,490	I541L	probably benign	Het
Ggn	A	G	7: 29,172,304	T370A	probably benign	Het
Ghr	A	G	15: 3,388,634		probably benign	Het
Gm6605	C	A	7: 38,448,275		noncoding transcript	Het
Gpr68	G	C	12: 100,878,556	P243R	probably damaging	Het
Gtf3c2	G	T	5: 31,159,518	Y720*	probably null	Het
Il2rb	T	A	15: 78,481,936	Y387F	possibly damaging	Het
Kcnu1	T	A	8: 25,937,501	V282E	probably damaging	Het
Krt222	G	A	11: 99,236,192	Q201*	probably null	Het
Mroh2a	GT	GTT	1: 88,256,166		probably null	Het
Myh7	T	C	14: 54,985,496	I751V	probably benign	Het
Mypn	A	G	10: 63,162,244	I429T	probably benign	Het
Nemf	A	T	12: 69,322,271	D723E	probably benign	Het
Nlrp4b	T	C	7: 10,714,530	L220P	probably damaging	Het
Npr3	T	A	15: 11,851,450	D418V	probably damaging	Het
Nsd3	A	G	8: 25,710,691	N1270S	probably damaging	Het
Olfr123	A	G	17: 37,796,102	I219M	probably damaging	Het
Olfr344	T	C	2: 36,568,822	S75P	probably damaging	Het
Otogl	G	A	10: 107,789,040	T1579I	possibly damaging	Het
Pkp2	T	A	16: 16,269,783		probably benign	Het
Psd3	T	C	8: 67,720,946	Y301C	probably damaging	Het
Psmb4	T	C	3: 94,886,168	H134R	probably damaging	Het
Ralgapb	A	G	2: 158,492,961	T1043A	probably benign	Het
Sec14l5	T	A	16: 5,178,485		probably null	Het
Serpina12	T	A	12: 104,031,140	Q374L	probably damaging	Het
Serpinb10	C	T	1: 107,546,962	R362*	probably null	Het
Sorcs1	T	A	19: 50,252,701	I416F	possibly damaging	Het
Sparcl1	T	C	5: 104,093,312	D82G	probably damaging	Het
Stat6	A	T	10: 127,648,116	Q89L	probably damaging	Het
Tat	A	G	8: 109,991,638	T52A	possibly damaging	Het
Yipf7	T	A	5: 69,521,063	I128F	probably benign	Het
Zfp112	T	A	7: 24,125,863	C419S	probably damaging	Het
Zzef1	A	G	11: 72,851,900	I769V	probably benign	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTCAGACTGTTCAGCCTACCCC -3'
(R):5'- ATGCAGACGCTGCTGATGAGAC -3'

Sequencing Primer
(F):5'- ACCTGTTGCTGAAGCTCCAAG -3'
(R):5'- CTGCTGATGAGACTTCAGGAC -3'

Posted On

2013-07-11