Incidental Mutation 'R7256:Papola'
ID 564290
Institutional Source Beutler Lab
Gene Symbol Papola
Ensembl Gene ENSMUSG00000021111
Gene Name poly (A) polymerase alpha
Synonyms PapIII, Plap
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.895) question?
Stock # R7256 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 105784694-105838944 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 105809345 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 204 (C204S)
Ref Sequence ENSEMBL: ENSMUSP00000126275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021535] [ENSMUST00000109901] [ENSMUST00000163473] [ENSMUST00000164326] [ENSMUST00000166329] [ENSMUST00000166735] [ENSMUST00000168186] [ENSMUST00000170002] [ENSMUST00000169938] [ENSMUST00000170540]
AlphaFold Q61183
Predicted Effect probably damaging
Transcript: ENSMUST00000021535
AA Change: C204S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021535
Gene: ENSMUSG00000021111
AA Change: C204S

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 1.5e-111 PFAM
Pfam:NTP_transf_2 75 175 2.4e-11 PFAM
Pfam:PAP_RNA-bind 366 508 8.9e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109901
AA Change: C204S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105527
Gene: ENSMUSG00000021111
AA Change: C204S

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:PAP_central 21 364 4.1e-120 PFAM
Pfam:NTP_transf_2 82 175 8.1e-16 PFAM
Pfam:PAP_RNA-bind 366 435 4.1e-21 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163473
AA Change: C204S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131668
Gene: ENSMUSG00000021111
AA Change: C204S

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 9.2e-112 PFAM
Pfam:NTP_transf_2 75 175 3.3e-11 PFAM
Pfam:PAP_RNA-bind 366 508 4.6e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 667 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163805
Predicted Effect probably benign
Transcript: ENSMUST00000164326
SMART Domains Protein: ENSMUSP00000125818
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 64 9.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164798
SMART Domains Protein: ENSMUSP00000125898
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 1 36 5.3e-8 PFAM
Pfam:PAP_RNA-bind 38 106 8.5e-22 PFAM
low complexity region 190 206 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
low complexity region 276 293 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165584
Predicted Effect probably benign
Transcript: ENSMUST00000166329
SMART Domains Protein: ENSMUSP00000131725
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 99 4.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166471
SMART Domains Protein: ENSMUSP00000132353
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 1 53 9.5e-21 PFAM
Pfam:PAP_RNA-bind 55 123 1.3e-21 PFAM
low complexity region 207 223 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
low complexity region 294 311 N/A INTRINSIC
low complexity region 335 357 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166498
Predicted Effect possibly damaging
Transcript: ENSMUST00000166735
AA Change: C204S

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128908
Gene: ENSMUSG00000021111
AA Change: C204S

DomainStartEndE-ValueType
Pfam:PAP_central 17 283 9.4e-73 PFAM
Pfam:NTP_transf_2 72 175 5.7e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168186
AA Change: C204S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128402
Gene: ENSMUSG00000021111
AA Change: C204S

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 1.1e-111 PFAM
Pfam:NTP_transf_2 75 175 3.6e-11 PFAM
Pfam:PAP_RNA-bind 366 508 5e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
low complexity region 698 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170002
AA Change: C204S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126275
Gene: ENSMUSG00000021111
AA Change: C204S

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 1e-111 PFAM
Pfam:NTP_transf_2 75 175 3.5e-11 PFAM
Pfam:PAP_RNA-bind 366 508 4.8e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 663 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000169938
SMART Domains Protein: ENSMUSP00000130687
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 157 4.5e-17 PFAM
Pfam:NTP_transf_2 74 166 2.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170540
Predicted Effect
SMART Domains Protein: ENSMUSP00000130798
Gene: ENSMUSG00000021111
AA Change: C19S

DomainStartEndE-ValueType
Pfam:PAP_central 1 95 5e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172040
Meta Mutation Damage Score 0.9190 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the poly(A) polymerase family. It is required for the addition of adenosine residues for the creation of the 3'-poly(A) tail of mRNAs. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,863,035 Y790H probably damaging Het
Bend3 A C 10: 43,493,671 S7R probably benign Het
Ccdc106 A G 7: 5,060,326 T277A probably damaging Het
Ccdc162 G A 10: 41,556,001 A1832V probably damaging Het
Ccser1 A G 6: 61,311,867 E338G probably benign Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cecr2 T C 6: 120,762,529 S1406P probably benign Het
Cep290 A G 10: 100,546,498 T208A probably damaging Het
Cep85l A C 10: 53,296,255 C569W probably damaging Het
Ces5a G A 8: 93,499,526 T527I probably benign Het
Clca2 T A 3: 145,090,847 I200F probably damaging Het
Cmas G A 6: 142,770,586 D251N probably damaging Het
Ctcfl G T 2: 173,118,475 A105E probably benign Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
Dctn6 A T 8: 34,090,808 I170N probably damaging Het
Dnah2 T C 11: 69,431,094 Y3800C probably damaging Het
Dsg2 G A 18: 20,591,931 V465I possibly damaging Het
Dzip1 T C 14: 118,885,646 T646A probably benign Het
Etv4 T A 11: 101,784,325 probably null Het
Exoc3l2 T C 7: 19,484,703 V549A unknown Het
Ficd G T 5: 113,738,819 A352S probably damaging Het
Fry T G 5: 150,466,786 I179S Het
Galntl5 A G 5: 25,195,300 H109R probably benign Het
Garem1 C A 18: 21,148,754 G182W probably damaging Het
Gm10696 T C 3: 94,176,360 E48G probably benign Het
Gm13078 T A 4: 143,726,279 D93E probably benign Het
Gm5916 A T 9: 36,120,989 Y50N possibly damaging Het
Gtf2h2 A T 13: 100,479,201 F271I probably benign Het
Hivep2 G T 10: 14,129,101 S481I probably benign Het
Homez T A 14: 54,857,420 Q277L probably damaging Het
Hoxb4 C A 11: 96,319,896 probably null Het
Igll1 A G 16: 16,861,093 S118P probably damaging Het
Ikzf2 A C 1: 69,578,053 probably null Het
Kif5b A G 18: 6,225,340 V230A probably damaging Het
Ldlr T A 9: 21,745,744 V719E probably benign Het
Lsm7 G A 10: 80,853,731 R66W possibly damaging Het
Map3k13 T A 16: 21,892,238 D90E probably benign Het
Mmrn1 A G 6: 60,976,114 K460E probably damaging Het
Myh10 A C 11: 68,790,689 N1061H probably damaging Het
Nepn A G 10: 52,400,993 Q275R probably benign Het
Noc3l A T 19: 38,812,356 D227E probably benign Het
Nploc4 G T 11: 120,428,550 S61R probably benign Het
Nr4a2 T C 2: 57,112,369 Y24C probably damaging Het
Nup160 T A 2: 90,723,355 I1143N probably damaging Het
Olfr1097 A G 2: 86,890,612 S188P probably damaging Het
Olfr1234 A T 2: 89,362,494 Y312N probably benign Het
Olfr294 G T 7: 86,615,665 H327N probably benign Het
Olfr895 T A 9: 38,268,708 M57K probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pgap1 A T 1: 54,493,207 probably null Het
Pitrm1 A G 13: 6,556,597 H229R probably damaging Het
Plcl1 A G 1: 55,698,218 Q906R probably benign Het
Ppfia3 T C 7: 45,341,743 N1018S probably benign Het
Prkd1 A G 12: 50,388,342 V534A possibly damaging Het
Pygm A T 19: 6,385,896 I126F probably benign Het
Rag1 T C 2: 101,642,070 Y909C probably damaging Het
Rasgrf2 G A 13: 91,884,518 Q560* probably null Het
Rbp3 A T 14: 33,962,583 I1190F possibly damaging Het
Reln T C 5: 21,978,923 K1693E probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rsph3a A G 17: 7,946,170 T121A probably benign Het
Rufy3 A G 5: 88,614,947 N112S possibly damaging Het
Ryr3 G A 2: 112,672,246 Q3548* probably null Het
Sardh A T 2: 27,218,812 V637D probably benign Het
Spata16 T C 3: 26,667,867 V179A probably benign Het
Tbc1d30 G A 10: 121,288,965 T319I probably damaging Het
Tlr2 T A 3: 83,837,606 Q390L possibly damaging Het
Tmem53 C T 4: 117,252,040 probably null Het
Vmn1r113 T A 7: 20,787,445 I54N probably damaging Het
Vmn1r223 A C 13: 23,249,866 Y210S probably damaging Het
Zbbx A T 3: 75,039,898 H670Q probably benign Het
Other mutations in Papola
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Papola APN 12 105809597 nonsense probably null
IGL02197:Papola APN 12 105829183 missense possibly damaging 0.90
IGL02511:Papola APN 12 105809345 missense probably damaging 0.99
IGL02608:Papola APN 12 105809559 missense probably damaging 1.00
IGL03081:Papola APN 12 105818855 missense probably damaging 1.00
IGL03378:Papola APN 12 105809433 critical splice donor site probably null
IGL03401:Papola APN 12 105829122 missense probably benign 0.19
R0027:Papola UTSW 12 105833136 missense probably benign 0.12
R0027:Papola UTSW 12 105833136 missense probably benign 0.12
R0325:Papola UTSW 12 105807193 missense probably damaging 1.00
R0372:Papola UTSW 12 105818838 missense probably benign 0.05
R1553:Papola UTSW 12 105820410 missense probably benign 0.30
R1746:Papola UTSW 12 105807209 missense probably benign 0.12
R1954:Papola UTSW 12 105828273 splice site probably null
R2424:Papola UTSW 12 105827052 missense probably benign 0.02
R4133:Papola UTSW 12 105799658 missense possibly damaging 0.83
R4156:Papola UTSW 12 105800751 critical splice donor site probably null
R4718:Papola UTSW 12 105820448 missense possibly damaging 0.72
R4814:Papola UTSW 12 105799653 missense probably damaging 1.00
R5115:Papola UTSW 12 105826960 missense probably benign 0.08
R5237:Papola UTSW 12 105826960 missense probably benign 0.08
R5372:Papola UTSW 12 105827050 missense probably benign 0.00
R5420:Papola UTSW 12 105806495 missense possibly damaging 0.95
R5430:Papola UTSW 12 105809584 missense probably damaging 1.00
R5831:Papola UTSW 12 105823600 missense probably benign 0.01
R5944:Papola UTSW 12 105812385 missense possibly damaging 0.87
R5956:Papola UTSW 12 105811041 missense probably damaging 1.00
R6143:Papola UTSW 12 105826960 missense probably benign 0.08
R6193:Papola UTSW 12 105820346 missense probably benign 0.42
R6413:Papola UTSW 12 105806504 start gained probably benign
R6490:Papola UTSW 12 105804937 missense probably benign 0.40
R6649:Papola UTSW 12 105812307 missense possibly damaging 0.72
R6891:Papola UTSW 12 105809691 unclassified probably benign
R7147:Papola UTSW 12 105808638 start gained probably benign
R7177:Papola UTSW 12 105809531 missense possibly damaging 0.95
R7178:Papola UTSW 12 105807184 missense probably damaging 1.00
R7583:Papola UTSW 12 105811045 missense probably damaging 1.00
R8093:Papola UTSW 12 105809577 missense probably damaging 0.96
R8945:Papola UTSW 12 105809687 unclassified probably benign
R9177:Papola UTSW 12 105799773 missense probably benign 0.00
R9249:Papola UTSW 12 105833144 missense probably benign 0.00
R9268:Papola UTSW 12 105799773 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTACGTAAGGCTGAGGCTG -3'
(R):5'- TGCCCTGTTGATAAGGGAAAAGC -3'

Sequencing Primer
(F):5'- TGAGGCTGGGCAAACTGC -3'
(R):5'- CCTGTTGATAAGGGAAAAGCAAAAAG -3'
Posted On 2019-06-26