Mutagenetix > Incidental Mutation

Incidental Mutation 'R7256:Rasgrf2'

564293

Institutional Source

Beutler Lab

Gene Symbol

Rasgrf2

Ensembl Gene

ENSMUSG00000021708

Gene Name

RAS protein-specific guanine nucleotide-releasing factor 2

Synonyms

Grf2, 6330417G04Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.165) question?

Stock #

R7256 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

91880400-92131656 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 91884518 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 560 (Q560*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099326]

AlphaFold

P70392

Predicted Effect

probably null
Transcript: ENSMUST00000099326
AA Change: Q1161*

SMART Domains

Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: Q1161*

Domain	Start	End	E-Value	Type
PH	23	135	1.29e-16	SMART
IQ	204	226	1.3e0	SMART
RhoGEF	247	428	2.2e-51	SMART
RasGEFN	633	775	9.35e-15	SMART
RasGEFN	786	923	6.04e-9	SMART
RasGEF	949	1186	2.97e-112	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000151408
AA Change: Q560*

SMART Domains

Protein: ENSMUSP00000116892
Gene: ENSMUSG00000021708
AA Change: Q560*

Domain	Start	End	E-Value	Type
RasGEFN	33	175	9.35e-15	SMART
RasGEFN	186	323	6.04e-9	SMART
RasGEF	349	586	2.97e-112	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts5	A	G	16: 85,863,035	Y790H	probably damaging	Het
Bend3	A	C	10: 43,493,671	S7R	probably benign	Het
Ccdc106	A	G	7: 5,060,326	T277A	probably damaging	Het
Ccdc162	G	A	10: 41,556,001	A1832V	probably damaging	Het
Ccser1	A	G	6: 61,311,867	E338G	probably benign	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cecr2	T	C	6: 120,762,529	S1406P	probably benign	Het
Cep290	A	G	10: 100,546,498	T208A	probably damaging	Het
Cep85l	A	C	10: 53,296,255	C569W	probably damaging	Het
Ces5a	G	A	8: 93,499,526	T527I	probably benign	Het
Clca2	T	A	3: 145,090,847	I200F	probably damaging	Het
Cmas	G	A	6: 142,770,586	D251N	probably damaging	Het
Ctcfl	G	T	2: 173,118,475	A105E	probably benign	Het
Dclk2	C	T	3: 86,793,259	R638H	probably damaging	Het
Dctn6	A	T	8: 34,090,808	I170N	probably damaging	Het
Dnah2	T	C	11: 69,431,094	Y3800C	probably damaging	Het
Dsg2	G	A	18: 20,591,931	V465I	possibly damaging	Het
Dzip1	T	C	14: 118,885,646	T646A	probably benign	Het
Etv4	T	A	11: 101,784,325		probably null	Het
Exoc3l2	T	C	7: 19,484,703	V549A	unknown	Het
Ficd	G	T	5: 113,738,819	A352S	probably damaging	Het
Fry	T	G	5: 150,466,786	I179S		Het
Galntl5	A	G	5: 25,195,300	H109R	probably benign	Het
Garem1	C	A	18: 21,148,754	G182W	probably damaging	Het
Gm10696	T	C	3: 94,176,360	E48G	probably benign	Het
Gm13078	T	A	4: 143,726,279	D93E	probably benign	Het
Gm5916	A	T	9: 36,120,989	Y50N	possibly damaging	Het
Gtf2h2	A	T	13: 100,479,201	F271I	probably benign	Het
Hivep2	G	T	10: 14,129,101	S481I	probably benign	Het
Homez	T	A	14: 54,857,420	Q277L	probably damaging	Het
Hoxb4	C	A	11: 96,319,896		probably null	Het
Igll1	A	G	16: 16,861,093	S118P	probably damaging	Het
Ikzf2	A	C	1: 69,578,053		probably null	Het
Kif5b	A	G	18: 6,225,340	V230A	probably damaging	Het
Ldlr	T	A	9: 21,745,744	V719E	probably benign	Het
Lsm7	G	A	10: 80,853,731	R66W	possibly damaging	Het
Map3k13	T	A	16: 21,892,238	D90E	probably benign	Het
Mmrn1	A	G	6: 60,976,114	K460E	probably damaging	Het
Myh10	A	C	11: 68,790,689	N1061H	probably damaging	Het
Nepn	A	G	10: 52,400,993	Q275R	probably benign	Het
Noc3l	A	T	19: 38,812,356	D227E	probably benign	Het
Nploc4	G	T	11: 120,428,550	S61R	probably benign	Het
Nr4a2	T	C	2: 57,112,369	Y24C	probably damaging	Het
Nup160	T	A	2: 90,723,355	I1143N	probably damaging	Het
Olfr1097	A	G	2: 86,890,612	S188P	probably damaging	Het
Olfr1234	A	T	2: 89,362,494	Y312N	probably benign	Het
Olfr294	G	T	7: 86,615,665	H327N	probably benign	Het
Olfr895	T	A	9: 38,268,708	M57K	probably damaging	Het
Papola	T	A	12: 105,809,345	C204S	probably damaging	Het
Peg10	CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG	CCACATCAGGATCCACATCAGGATGCACATCAG	6: 4,756,398		probably benign	Het
Pgap1	A	T	1: 54,493,207		probably null	Het
Pitrm1	A	G	13: 6,556,597	H229R	probably damaging	Het
Plcl1	A	G	1: 55,698,218	Q906R	probably benign	Het
Ppfia3	T	C	7: 45,341,743	N1018S	probably benign	Het
Prkd1	A	G	12: 50,388,342	V534A	possibly damaging	Het
Pygm	A	T	19: 6,385,896	I126F	probably benign	Het
Rag1	T	C	2: 101,642,070	Y909C	probably damaging	Het
Rbp3	A	T	14: 33,962,583	I1190F	possibly damaging	Het
Reln	T	C	5: 21,978,923	K1693E	probably benign	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Rsph3a	A	G	17: 7,946,170	T121A	probably benign	Het
Rufy3	A	G	5: 88,614,947	N112S	possibly damaging	Het
Ryr3	G	A	2: 112,672,246	Q3548*	probably null	Het
Sardh	A	T	2: 27,218,812	V637D	probably benign	Het
Spata16	T	C	3: 26,667,867	V179A	probably benign	Het
Tbc1d30	G	A	10: 121,288,965	T319I	probably damaging	Het
Tlr2	T	A	3: 83,837,606	Q390L	possibly damaging	Het
Tmem53	C	T	4: 117,252,040		probably null	Het
Vmn1r113	T	A	7: 20,787,445	I54N	probably damaging	Het
Vmn1r223	A	C	13: 23,249,866	Y210S	probably damaging	Het
Zbbx	A	T	3: 75,039,898	H670Q	probably benign	Het

Other mutations in Rasgrf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Rasgrf2	APN	13	92022917	splice site	probably benign
IGL01358:Rasgrf2	APN	13	91982630	missense	probably benign	0.23
IGL01666:Rasgrf2	APN	13	92038210	missense	probably damaging	1.00
IGL01930:Rasgrf2	APN	13	91982738	missense	probably damaging	0.98
IGL02230:Rasgrf2	APN	13	91988026	missense	probably damaging	1.00
IGL02630:Rasgrf2	APN	13	92131392	missense	probably damaging	1.00
IGL02690:Rasgrf2	APN	13	92030765	missense	probably damaging	1.00
IGL02943:Rasgrf2	APN	13	91983633	missense	probably damaging	1.00
IGL03067:Rasgrf2	APN	13	92022905	missense	probably damaging	0.97
IGL03342:Rasgrf2	APN	13	91987979	missense	probably damaging	1.00
IGL03405:Rasgrf2	APN	13	91896051	missense	probably damaging	1.00
R0620:Rasgrf2	UTSW	13	91919817	splice site	probably benign
R0632:Rasgrf2	UTSW	13	91972274	missense	probably benign	0.00
R0894:Rasgrf2	UTSW	13	91982771	missense	probably damaging	1.00
R1354:Rasgrf2	UTSW	13	92028666	missense	probably damaging	1.00
R1400:Rasgrf2	UTSW	13	91887689	missense	probably damaging	1.00
R1437:Rasgrf2	UTSW	13	92030888	missense	probably damaging	1.00
R1443:Rasgrf2	UTSW	13	91983676	missense	probably damaging	1.00
R1522:Rasgrf2	UTSW	13	91896086	missense	probably benign	0.00
R1553:Rasgrf2	UTSW	13	91890664	missense	probably damaging	1.00
R1613:Rasgrf2	UTSW	13	91902621	missense	probably damaging	1.00
R1883:Rasgrf2	UTSW	13	91969030	missense	probably benign
R1934:Rasgrf2	UTSW	13	91983706	splice site	probably null
R1990:Rasgrf2	UTSW	13	92035965	missense	probably damaging	1.00
R2037:Rasgrf2	UTSW	13	91902629	missense	probably damaging	0.99
R2043:Rasgrf2	UTSW	13	92030843	missense	possibly damaging	0.91
R2135:Rasgrf2	UTSW	13	91972255	missense	probably benign
R2193:Rasgrf2	UTSW	13	92023713	splice site	probably null
R2406:Rasgrf2	UTSW	13	91972240	missense	probably benign
R3055:Rasgrf2	UTSW	13	92029075	missense	probably damaging	1.00
R3916:Rasgrf2	UTSW	13	92030788	missense	probably damaging	1.00
R3954:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3955:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3956:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R4133:Rasgrf2	UTSW	13	91982654	missense	possibly damaging	0.59
R4177:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4178:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4357:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4358:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4359:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4439:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4440:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4441:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4564:Rasgrf2	UTSW	13	91885654	nonsense	probably null
R4576:Rasgrf2	UTSW	13	91896410	missense	possibly damaging	0.58
R4590:Rasgrf2	UTSW	13	92038281	missense	probably damaging	1.00
R4718:Rasgrf2	UTSW	13	91990830	critical splice donor site	probably null
R4778:Rasgrf2	UTSW	13	91983661	missense	probably damaging	0.99
R4790:Rasgrf2	UTSW	13	91988016	missense	probably damaging	1.00
R4808:Rasgrf2	UTSW	13	92023682	missense	probably damaging	1.00
R5151:Rasgrf2	UTSW	13	91896036	missense	probably damaging	1.00
R5286:Rasgrf2	UTSW	13	92131433	missense	possibly damaging	0.94
R5902:Rasgrf2	UTSW	13	91919892	missense	probably damaging	1.00
R6180:Rasgrf2	UTSW	13	92029101	missense	probably damaging	1.00
R6264:Rasgrf2	UTSW	13	92030785	missense	probably damaging	1.00
R6369:Rasgrf2	UTSW	13	92131446	missense	probably benign
R6428:Rasgrf2	UTSW	13	91987981	missense	probably damaging	1.00
R6595:Rasgrf2	UTSW	13	92030853	missense	probably damaging	1.00
R6619:Rasgrf2	UTSW	13	92028519	missense	probably damaging	1.00
R6988:Rasgrf2	UTSW	13	91885635	missense	probably benign	0.02
R7026:Rasgrf2	UTSW	13	91983613	missense	probably damaging	1.00
R7038:Rasgrf2	UTSW	13	91982833	missense	possibly damaging	0.95
R7045:Rasgrf2	UTSW	13	92022592	intron	probably benign
R7056:Rasgrf2	UTSW	13	92030695	missense	probably damaging	0.99
R7058:Rasgrf2	UTSW	13	91886402	missense	probably damaging	0.99
R7392:Rasgrf2	UTSW	13	91893737	missense
R7469:Rasgrf2	UTSW	13	92029022	critical splice donor site	probably null
R7618:Rasgrf2	UTSW	13	91987966	missense
R7641:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7674:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7784:Rasgrf2	UTSW	13	91896082	missense
R7962:Rasgrf2	UTSW	13	92030792	missense	probably damaging	0.99
R8056:Rasgrf2	UTSW	13	92030813	missense	probably damaging	0.97
R8218:Rasgrf2	UTSW	13	91982677	missense
R8796:Rasgrf2	UTSW	13	91890566	missense
R8913:Rasgrf2	UTSW	13	92022526	missense	probably benign	0.05
R8971:Rasgrf2	UTSW	13	92021717	missense	possibly damaging	0.80
R9020:Rasgrf2	UTSW	13	92028638	missense	possibly damaging	0.93
R9487:Rasgrf2	UTSW	13	92131251	missense	probably benign
R9562:Rasgrf2	UTSW	13	91886350	critical splice donor site	probably null
R9712:Rasgrf2	UTSW	13	91987973	missense
R9766:Rasgrf2	UTSW	13	92023680	missense	probably damaging	1.00
R9800:Rasgrf2	UTSW	13	92131352	missense	probably damaging	0.99
X0013:Rasgrf2	UTSW	13	92030855	missense	probably damaging	1.00
X0026:Rasgrf2	UTSW	13	91902535	missense	probably damaging	0.99
Z1177:Rasgrf2	UTSW	13	91983513	missense
Z1177:Rasgrf2	UTSW	13	92022573	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AAAGGAGGCAGGTGTTGTCC -3'
(R):5'- CTCTTAAGGACACTGACTGGG -3'

Sequencing Primer
(F):5'- AGGCAGGTGTTGTCCCTCTG -3'
(R):5'- GTCTCAGGGAAAATGTTGAG -3'

Posted On

2019-06-26