Incidental Mutation 'R7256:Rasgrf2'
ID564293
Institutional Source Beutler Lab
Gene Symbol Rasgrf2
Ensembl Gene ENSMUSG00000021708
Gene NameRAS protein-specific guanine nucleotide-releasing factor 2
SynonymsGrf2, 6330417G04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R7256 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location91880400-92131656 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 91884518 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 560 (Q560*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099326]
Predicted Effect probably null
Transcript: ENSMUST00000099326
AA Change: Q1161*
SMART Domains Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: Q1161*

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
RhoGEF 247 428 2.2e-51 SMART
RasGEFN 633 775 9.35e-15 SMART
RasGEFN 786 923 6.04e-9 SMART
RasGEF 949 1186 2.97e-112 SMART
Predicted Effect probably null
Transcript: ENSMUST00000151408
AA Change: Q560*
SMART Domains Protein: ENSMUSP00000116892
Gene: ENSMUSG00000021708
AA Change: Q560*

DomainStartEndE-ValueType
RasGEFN 33 175 9.35e-15 SMART
RasGEFN 186 323 6.04e-9 SMART
RasGEF 349 586 2.97e-112 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,863,035 Y790H probably damaging Het
Bend3 A C 10: 43,493,671 S7R probably benign Het
Ccdc106 A G 7: 5,060,326 T277A probably damaging Het
Ccdc162 G A 10: 41,556,001 A1832V probably damaging Het
Ccser1 A G 6: 61,311,867 E338G probably benign Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cecr2 T C 6: 120,762,529 S1406P probably benign Het
Cep290 A G 10: 100,546,498 T208A probably damaging Het
Cep85l A C 10: 53,296,255 C569W probably damaging Het
Ces5a G A 8: 93,499,526 T527I probably benign Het
Clca2 T A 3: 145,090,847 I200F probably damaging Het
Cmas G A 6: 142,770,586 D251N probably damaging Het
Ctcfl G T 2: 173,118,475 A105E probably benign Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
Dctn6 A T 8: 34,090,808 I170N probably damaging Het
Dnah2 T C 11: 69,431,094 Y3800C probably damaging Het
Dsg2 G A 18: 20,591,931 V465I possibly damaging Het
Dzip1 T C 14: 118,885,646 T646A probably benign Het
Etv4 T A 11: 101,784,325 probably null Het
Exoc3l2 T C 7: 19,484,703 V549A unknown Het
Ficd G T 5: 113,738,819 A352S probably damaging Het
Fry T G 5: 150,466,786 I179S Het
Galntl5 A G 5: 25,195,300 H109R probably benign Het
Garem1 C A 18: 21,148,754 G182W probably damaging Het
Gm10696 T C 3: 94,176,360 E48G probably benign Het
Gm13078 T A 4: 143,726,279 D93E probably benign Het
Gm5916 A T 9: 36,120,989 Y50N possibly damaging Het
Gtf2h2 A T 13: 100,479,201 F271I probably benign Het
Hivep2 G T 10: 14,129,101 S481I probably benign Het
Homez T A 14: 54,857,420 Q277L probably damaging Het
Hoxb4 C A 11: 96,319,896 probably null Het
Igll1 A G 16: 16,861,093 S118P probably damaging Het
Ikzf2 A C 1: 69,578,053 probably null Het
Kif5b A G 18: 6,225,340 V230A probably damaging Het
Ldlr T A 9: 21,745,744 V719E probably benign Het
Lsm7 G A 10: 80,853,731 R66W possibly damaging Het
Map3k13 T A 16: 21,892,238 D90E probably benign Het
Mmrn1 A G 6: 60,976,114 K460E probably damaging Het
Myh10 A C 11: 68,790,689 N1061H probably damaging Het
Nepn A G 10: 52,400,993 Q275R probably benign Het
Noc3l A T 19: 38,812,356 D227E probably benign Het
Nploc4 G T 11: 120,428,550 S61R probably benign Het
Nr4a2 T C 2: 57,112,369 Y24C probably damaging Het
Nup160 T A 2: 90,723,355 I1143N probably damaging Het
Olfr1097 A G 2: 86,890,612 S188P probably damaging Het
Olfr1234 A T 2: 89,362,494 Y312N probably benign Het
Olfr294 G T 7: 86,615,665 H327N probably benign Het
Olfr895 T A 9: 38,268,708 M57K probably damaging Het
Papola T A 12: 105,809,345 C204S probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pgap1 A T 1: 54,493,207 probably null Het
Pitrm1 A G 13: 6,556,597 H229R probably damaging Het
Plcl1 A G 1: 55,698,218 Q906R probably benign Het
Ppfia3 T C 7: 45,341,743 N1018S probably benign Het
Prkd1 A G 12: 50,388,342 V534A possibly damaging Het
Pygm A T 19: 6,385,896 I126F probably benign Het
Rag1 T C 2: 101,642,070 Y909C probably damaging Het
Rbp3 A T 14: 33,962,583 I1190F possibly damaging Het
Reln T C 5: 21,978,923 K1693E probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rsph3a A G 17: 7,946,170 T121A probably benign Het
Rufy3 A G 5: 88,614,947 N112S possibly damaging Het
Ryr3 G A 2: 112,672,246 Q3548* probably null Het
Sardh A T 2: 27,218,812 V637D probably benign Het
Spata16 T C 3: 26,667,867 V179A probably benign Het
Tbc1d30 G A 10: 121,288,965 T319I probably damaging Het
Tlr2 T A 3: 83,837,606 Q390L possibly damaging Het
Tmem53 C T 4: 117,252,040 probably null Het
Vmn1r113 T A 7: 20,787,445 I54N probably damaging Het
Vmn1r223 A C 13: 23,249,866 Y210S probably damaging Het
Zbbx A T 3: 75,039,898 H670Q probably benign Het
Other mutations in Rasgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rasgrf2 APN 13 92022917 splice site probably benign
IGL01358:Rasgrf2 APN 13 91982630 missense probably benign 0.23
IGL01666:Rasgrf2 APN 13 92038210 missense probably damaging 1.00
IGL01930:Rasgrf2 APN 13 91982738 missense probably damaging 0.98
IGL02230:Rasgrf2 APN 13 91988026 missense probably damaging 1.00
IGL02630:Rasgrf2 APN 13 92131392 missense probably damaging 1.00
IGL02690:Rasgrf2 APN 13 92030765 missense probably damaging 1.00
IGL02943:Rasgrf2 APN 13 91983633 missense probably damaging 1.00
IGL03067:Rasgrf2 APN 13 92022905 missense probably damaging 0.97
IGL03342:Rasgrf2 APN 13 91987979 missense probably damaging 1.00
IGL03405:Rasgrf2 APN 13 91896051 missense probably damaging 1.00
R0620:Rasgrf2 UTSW 13 91919817 splice site probably benign
R0632:Rasgrf2 UTSW 13 91972274 missense probably benign 0.00
R0894:Rasgrf2 UTSW 13 91982771 missense probably damaging 1.00
R1354:Rasgrf2 UTSW 13 92028666 missense probably damaging 1.00
R1400:Rasgrf2 UTSW 13 91887689 missense probably damaging 1.00
R1437:Rasgrf2 UTSW 13 92030888 missense probably damaging 1.00
R1443:Rasgrf2 UTSW 13 91983676 missense probably damaging 1.00
R1522:Rasgrf2 UTSW 13 91896086 missense probably benign 0.00
R1553:Rasgrf2 UTSW 13 91890664 missense probably damaging 1.00
R1613:Rasgrf2 UTSW 13 91902621 missense probably damaging 1.00
R1883:Rasgrf2 UTSW 13 91969030 missense probably benign
R1934:Rasgrf2 UTSW 13 91983706 splice site probably null
R1990:Rasgrf2 UTSW 13 92035965 missense probably damaging 1.00
R2037:Rasgrf2 UTSW 13 91902629 missense probably damaging 0.99
R2043:Rasgrf2 UTSW 13 92030843 missense possibly damaging 0.91
R2135:Rasgrf2 UTSW 13 91972255 missense probably benign
R2193:Rasgrf2 UTSW 13 92023713 splice site probably null
R2406:Rasgrf2 UTSW 13 91972240 missense probably benign
R3055:Rasgrf2 UTSW 13 92029075 missense probably damaging 1.00
R3916:Rasgrf2 UTSW 13 92030788 missense probably damaging 1.00
R3954:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R3955:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R3956:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R4133:Rasgrf2 UTSW 13 91982654 missense possibly damaging 0.59
R4177:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4178:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4357:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4358:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4359:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4439:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4440:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4441:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4564:Rasgrf2 UTSW 13 91885654 nonsense probably null
R4576:Rasgrf2 UTSW 13 91896410 missense possibly damaging 0.58
R4590:Rasgrf2 UTSW 13 92038281 missense probably damaging 1.00
R4718:Rasgrf2 UTSW 13 91990830 critical splice donor site probably null
R4778:Rasgrf2 UTSW 13 91983661 missense probably damaging 0.99
R4790:Rasgrf2 UTSW 13 91988016 missense probably damaging 1.00
R4808:Rasgrf2 UTSW 13 92023682 missense probably damaging 1.00
R5151:Rasgrf2 UTSW 13 91896036 missense probably damaging 1.00
R5286:Rasgrf2 UTSW 13 92131433 missense possibly damaging 0.94
R5902:Rasgrf2 UTSW 13 91919892 missense probably damaging 1.00
R6180:Rasgrf2 UTSW 13 92029101 missense probably damaging 1.00
R6264:Rasgrf2 UTSW 13 92030785 missense probably damaging 1.00
R6369:Rasgrf2 UTSW 13 92131446 missense probably benign
R6428:Rasgrf2 UTSW 13 91987981 missense probably damaging 1.00
R6595:Rasgrf2 UTSW 13 92030853 missense probably damaging 1.00
R6619:Rasgrf2 UTSW 13 92028519 missense probably damaging 1.00
R6988:Rasgrf2 UTSW 13 91885635 missense probably benign 0.02
R7026:Rasgrf2 UTSW 13 91983613 missense probably damaging 1.00
R7038:Rasgrf2 UTSW 13 91982833 missense possibly damaging 0.95
R7045:Rasgrf2 UTSW 13 92022592 intron probably benign
R7056:Rasgrf2 UTSW 13 92030695 missense probably damaging 0.99
R7058:Rasgrf2 UTSW 13 91886402 missense probably damaging 0.99
R7392:Rasgrf2 UTSW 13 91893737 missense
R7469:Rasgrf2 UTSW 13 92029022 critical splice donor site probably null
R7618:Rasgrf2 UTSW 13 91987966 missense
R7641:Rasgrf2 UTSW 13 92131406 missense possibly damaging 0.65
R7674:Rasgrf2 UTSW 13 92131406 missense possibly damaging 0.65
R7784:Rasgrf2 UTSW 13 91896082 missense
R7962:Rasgrf2 UTSW 13 92030792 missense probably damaging 0.99
R8056:Rasgrf2 UTSW 13 92030813 missense probably damaging 0.97
R8218:Rasgrf2 UTSW 13 91982677 missense
X0013:Rasgrf2 UTSW 13 92030855 missense probably damaging 1.00
X0026:Rasgrf2 UTSW 13 91902535 missense probably damaging 0.99
Z1177:Rasgrf2 UTSW 13 91983513 missense
Z1177:Rasgrf2 UTSW 13 92022573 missense unknown
Predicted Primers PCR Primer
(F):5'- AAAGGAGGCAGGTGTTGTCC -3'
(R):5'- CTCTTAAGGACACTGACTGGG -3'

Sequencing Primer
(F):5'- AGGCAGGTGTTGTCCCTCTG -3'
(R):5'- GTCTCAGGGAAAATGTTGAG -3'
Posted On2019-06-26