Mutagenetix > Incidental Mutation

Incidental Mutation 'R7256:Rbp3'

564295

Institutional Source

Beutler Lab

Gene Symbol

Rbp3

Ensembl Gene

ENSMUSG00000041534

Gene Name

retinol binding protein 3, interstitial

Synonyms

Rbp-3, Irbp

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R7256 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

33954003-33964216 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 33962583 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 1190 (I1190F)

Ref Sequence

ENSEMBL: ENSMUSP00000040249 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035695] [ENSMUST00000166737]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035695
AA Change: I1190F

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: I1190F

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
TSPc	109	308	5.72e-69	SMART
TSPc	416	616	1.98e-63	SMART
TSPc	720	917	5.34e-69	SMART
TSPc	1019	1216	2.13e-68	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166737

SMART Domains

Protein: ENSMUSP00000132436
Gene: ENSMUSG00000044519

Domain	Start	End	E-Value	Type
low complexity region	161	175	N/A	INTRINSIC
low complexity region	244	270	N/A	INTRINSIC
ZnF_C2H2	272	294	2.89e1	SMART
ZnF_C2H2	314	336	5.06e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts5	A	G	16: 85,863,035	Y790H	probably damaging	Het
Bend3	A	C	10: 43,493,671	S7R	probably benign	Het
Ccdc106	A	G	7: 5,060,326	T277A	probably damaging	Het
Ccdc162	G	A	10: 41,556,001	A1832V	probably damaging	Het
Ccser1	A	G	6: 61,311,867	E338G	probably benign	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cecr2	T	C	6: 120,762,529	S1406P	probably benign	Het
Cep290	A	G	10: 100,546,498	T208A	probably damaging	Het
Cep85l	A	C	10: 53,296,255	C569W	probably damaging	Het
Ces5a	G	A	8: 93,499,526	T527I	probably benign	Het
Clca2	T	A	3: 145,090,847	I200F	probably damaging	Het
Cmas	G	A	6: 142,770,586	D251N	probably damaging	Het
Ctcfl	G	T	2: 173,118,475	A105E	probably benign	Het
Dclk2	C	T	3: 86,793,259	R638H	probably damaging	Het
Dctn6	A	T	8: 34,090,808	I170N	probably damaging	Het
Dnah2	T	C	11: 69,431,094	Y3800C	probably damaging	Het
Dsg2	G	A	18: 20,591,931	V465I	possibly damaging	Het
Dzip1	T	C	14: 118,885,646	T646A	probably benign	Het
Etv4	T	A	11: 101,784,325		probably null	Het
Exoc3l2	T	C	7: 19,484,703	V549A	unknown	Het
Ficd	G	T	5: 113,738,819	A352S	probably damaging	Het
Fry	T	G	5: 150,466,786	I179S		Het
Galntl5	A	G	5: 25,195,300	H109R	probably benign	Het
Garem1	C	A	18: 21,148,754	G182W	probably damaging	Het
Gm10696	T	C	3: 94,176,360	E48G	probably benign	Het
Gm13078	T	A	4: 143,726,279	D93E	probably benign	Het
Gm5916	A	T	9: 36,120,989	Y50N	possibly damaging	Het
Gtf2h2	A	T	13: 100,479,201	F271I	probably benign	Het
Hivep2	G	T	10: 14,129,101	S481I	probably benign	Het
Homez	T	A	14: 54,857,420	Q277L	probably damaging	Het
Hoxb4	C	A	11: 96,319,896		probably null	Het
Igll1	A	G	16: 16,861,093	S118P	probably damaging	Het
Ikzf2	A	C	1: 69,578,053		probably null	Het
Kif5b	A	G	18: 6,225,340	V230A	probably damaging	Het
Ldlr	T	A	9: 21,745,744	V719E	probably benign	Het
Lsm7	G	A	10: 80,853,731	R66W	possibly damaging	Het
Map3k13	T	A	16: 21,892,238	D90E	probably benign	Het
Mmrn1	A	G	6: 60,976,114	K460E	probably damaging	Het
Myh10	A	C	11: 68,790,689	N1061H	probably damaging	Het
Nepn	A	G	10: 52,400,993	Q275R	probably benign	Het
Noc3l	A	T	19: 38,812,356	D227E	probably benign	Het
Nploc4	G	T	11: 120,428,550	S61R	probably benign	Het
Nr4a2	T	C	2: 57,112,369	Y24C	probably damaging	Het
Nup160	T	A	2: 90,723,355	I1143N	probably damaging	Het
Olfr1097	A	G	2: 86,890,612	S188P	probably damaging	Het
Olfr1234	A	T	2: 89,362,494	Y312N	probably benign	Het
Olfr294	G	T	7: 86,615,665	H327N	probably benign	Het
Olfr895	T	A	9: 38,268,708	M57K	probably damaging	Het
Papola	T	A	12: 105,809,345	C204S	probably damaging	Het
Peg10	CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG	CCACATCAGGATCCACATCAGGATGCACATCAG	6: 4,756,398		probably benign	Het
Pgap1	A	T	1: 54,493,207		probably null	Het
Pitrm1	A	G	13: 6,556,597	H229R	probably damaging	Het
Plcl1	A	G	1: 55,698,218	Q906R	probably benign	Het
Ppfia3	T	C	7: 45,341,743	N1018S	probably benign	Het
Prkd1	A	G	12: 50,388,342	V534A	possibly damaging	Het
Pygm	A	T	19: 6,385,896	I126F	probably benign	Het
Rag1	T	C	2: 101,642,070	Y909C	probably damaging	Het
Rasgrf2	G	A	13: 91,884,518	Q560*	probably null	Het
Reln	T	C	5: 21,978,923	K1693E	probably benign	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Rsph3a	A	G	17: 7,946,170	T121A	probably benign	Het
Rufy3	A	G	5: 88,614,947	N112S	possibly damaging	Het
Ryr3	G	A	2: 112,672,246	Q3548*	probably null	Het
Sardh	A	T	2: 27,218,812	V637D	probably benign	Het
Spata16	T	C	3: 26,667,867	V179A	probably benign	Het
Tbc1d30	G	A	10: 121,288,965	T319I	probably damaging	Het
Tlr2	T	A	3: 83,837,606	Q390L	possibly damaging	Het
Tmem53	C	T	4: 117,252,040		probably null	Het
Vmn1r113	T	A	7: 20,787,445	I54N	probably damaging	Het
Vmn1r223	A	C	13: 23,249,866	Y210S	probably damaging	Het
Zbbx	A	T	3: 75,039,898	H670Q	probably benign	Het

Other mutations in Rbp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01364:Rbp3	APN	14	33954188	missense	possibly damaging	0.82
IGL01643:Rbp3	APN	14	33956836	missense	probably benign	0.18
IGL01665:Rbp3	APN	14	33956131	missense	probably benign	0.02
IGL01809:Rbp3	APN	14	33955300	missense	probably damaging	1.00
IGL01975:Rbp3	APN	14	33958645	missense	probably damaging	1.00
IGL02349:Rbp3	APN	14	33955719	missense	probably damaging	0.97
IGL02447:Rbp3	APN	14	33954503	missense	probably damaging	1.00
IGL03192:Rbp3	APN	14	33958583	missense	possibly damaging	0.52
IGL03302:Rbp3	APN	14	33954659	missense	probably damaging	0.97
Behagt	UTSW	14	33954454	missense	probably benign	0.00
jagt	UTSW	14	33956482	missense	probably damaging	0.97
muntre	UTSW	14	33956356	missense	possibly damaging	0.95
Rotwild	UTSW	14	33956018	missense	probably damaging	1.00
P4717OSA:Rbp3	UTSW	14	33955499	missense	probably damaging	0.96
R0234:Rbp3	UTSW	14	33955901	missense	probably damaging	0.98
R0234:Rbp3	UTSW	14	33955901	missense	probably damaging	0.98
R0432:Rbp3	UTSW	14	33954773	missense	probably damaging	1.00
R0469:Rbp3	UTSW	14	33962419	missense	possibly damaging	0.95
R0652:Rbp3	UTSW	14	33958648	missense	possibly damaging	0.89
R0739:Rbp3	UTSW	14	33958647	missense	probably benign	0.28
R0747:Rbp3	UTSW	14	33956278	missense	possibly damaging	0.51
R0836:Rbp3	UTSW	14	33956638	missense	possibly damaging	0.84
R1102:Rbp3	UTSW	14	33956356	missense	possibly damaging	0.95
R1583:Rbp3	UTSW	14	33954524	missense	possibly damaging	0.45
R1589:Rbp3	UTSW	14	33955792	missense	probably damaging	0.99
R1595:Rbp3	UTSW	14	33956198	missense	possibly damaging	0.93
R1720:Rbp3	UTSW	14	33956909	missense	probably benign	0.38
R1830:Rbp3	UTSW	14	33954644	missense	probably benign	0.31
R1982:Rbp3	UTSW	14	33954545	missense	probably damaging	0.99
R1985:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R1985:Rbp3	UTSW	14	33956461	missense	probably benign	0.00
R2007:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2027:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2100:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2101:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2113:Rbp3	UTSW	14	33956057	missense	probably benign	0.00
R2138:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2183:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2248:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2277:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2306:Rbp3	UTSW	14	33962563	missense	probably damaging	1.00
R2504:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2696:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2697:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2698:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2920:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2940:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2971:Rbp3	UTSW	14	33954454	missense	probably benign	0.00
R3111:Rbp3	UTSW	14	33954112	missense	probably benign	0.01
R3155:Rbp3	UTSW	14	33957114	missense	probably damaging	0.98
R3156:Rbp3	UTSW	14	33957114	missense	probably damaging	0.98
R3751:Rbp3	UTSW	14	33956012	missense	probably damaging	0.98
R3752:Rbp3	UTSW	14	33956012	missense	probably damaging	0.98
R3851:Rbp3	UTSW	14	33955507	missense	probably damaging	0.98
R4016:Rbp3	UTSW	14	33955390	missense	possibly damaging	0.82
R4276:Rbp3	UTSW	14	33958650	missense	probably benign	0.24
R4277:Rbp3	UTSW	14	33958650	missense	probably benign	0.24
R4278:Rbp3	UTSW	14	33958650	missense	probably benign	0.24
R4382:Rbp3	UTSW	14	33955296	missense	probably benign	0.12
R4383:Rbp3	UTSW	14	33955296	missense	probably benign	0.12
R4385:Rbp3	UTSW	14	33955296	missense	probably benign	0.12
R4625:Rbp3	UTSW	14	33956099	missense	probably benign
R4712:Rbp3	UTSW	14	33960658	missense	probably damaging	0.97
R4812:Rbp3	UTSW	14	33954774	missense	probably damaging	0.99
R4918:Rbp3	UTSW	14	33955411	missense	probably damaging	1.00
R4971:Rbp3	UTSW	14	33954470	missense	probably damaging	0.98
R5262:Rbp3	UTSW	14	33954850	missense	probably damaging	1.00
R5387:Rbp3	UTSW	14	33956413	missense	possibly damaging	0.95
R5468:Rbp3	UTSW	14	33956627	missense	possibly damaging	0.93
R5837:Rbp3	UTSW	14	33954273	missense	probably benign	0.00
R5994:Rbp3	UTSW	14	33954900	missense	probably damaging	1.00
R6010:Rbp3	UTSW	14	33954647	missense	probably damaging	1.00
R6041:Rbp3	UTSW	14	33956482	missense	probably damaging	0.97
R6266:Rbp3	UTSW	14	33954461	missense	probably benign
R6357:Rbp3	UTSW	14	33957034	missense	probably damaging	0.99
R6457:Rbp3	UTSW	14	33955267	nonsense	probably null
R6777:Rbp3	UTSW	14	33954273	missense	probably benign	0.00
R7158:Rbp3	UTSW	14	33955556	missense	probably benign	0.00
R7183:Rbp3	UTSW	14	33955204	missense	probably benign	0.02
R7654:Rbp3	UTSW	14	33955840	missense	probably benign
R7756:Rbp3	UTSW	14	33954775	missense	probably benign	0.15
R7758:Rbp3	UTSW	14	33954775	missense	probably benign	0.15
R7784:Rbp3	UTSW	14	33954158	missense	probably benign	0.41
R7845:Rbp3	UTSW	14	33956464	missense	probably benign	0.24
R8176:Rbp3	UTSW	14	33955648	missense	possibly damaging	0.67
R8281:Rbp3	UTSW	14	33956363	missense	probably benign	0.00
R8393:Rbp3	UTSW	14	33956199	missense	possibly damaging	0.93
R8552:Rbp3	UTSW	14	33955664	missense	probably benign	0.01
R8717:Rbp3	UTSW	14	33956438	missense	probably damaging	0.99
R8730:Rbp3	UTSW	14	33955838	missense	probably benign
R8773:Rbp3	UTSW	14	33962535	missense	possibly damaging	0.71
R8836:Rbp3	UTSW	14	33958631	missense	possibly damaging	0.95
R8843:Rbp3	UTSW	14	33954565	missense	probably benign
R8880:Rbp3	UTSW	14	33956839	missense	probably benign	0.16
R8941:Rbp3	UTSW	14	33956529	missense	possibly damaging	0.92
R8971:Rbp3	UTSW	14	33955835	missense	probably damaging	1.00
R8998:Rbp3	UTSW	14	33962403	nonsense	probably null
R8999:Rbp3	UTSW	14	33962403	nonsense	probably null
R9436:Rbp3	UTSW	14	33955277	missense	possibly damaging	0.94
R9525:Rbp3	UTSW	14	33954445	missense	probably benign	0.00
R9563:Rbp3	UTSW	14	33955520	missense	probably damaging	1.00
R9564:Rbp3	UTSW	14	33955520	missense	probably damaging	1.00
R9723:Rbp3	UTSW	14	33955517	missense	possibly damaging	0.92
Z1177:Rbp3	UTSW	14	33954538	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- TGAACGATATGGCTCCAAGAAG -3'
(R):5'- TTAGGATCTCGTGCTGGAGC -3'

Sequencing Primer
(F):5'- CCGCCGAGGAATTTACT -3'
(R):5'- CAGTAGTGGCCCAGAGAGC -3'

Posted On

2019-06-26