Incidental Mutation 'R7256:Map3k13'
ID 564299
Institutional Source Beutler Lab
Gene Symbol Map3k13
Ensembl Gene ENSMUSG00000033618
Gene Name mitogen-activated protein kinase kinase kinase 13
Synonyms C130026N12Rik
MMRRC Submission 045317-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7256 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 21643923-21752189 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21710988 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 90 (D90E)
Ref Sequence ENSEMBL: ENSMUSP00000047388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042065] [ENSMUST00000231988] [ENSMUST00000232240]
AlphaFold Q1HKZ5
Predicted Effect probably benign
Transcript: ENSMUST00000042065
AA Change: D90E

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000047388
Gene: ENSMUSG00000033618
AA Change: D90E

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
Pfam:Pkinase 167 406 3.1e-60 PFAM
Pfam:Pkinase_Tyr 167 406 2.4e-65 PFAM
coiled coil region 456 502 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
low complexity region 805 821 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231988
AA Change: D90E

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000232240
AA Change: D90E

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase contains a dual leucine-zipper motif, and has been shown to form dimers/oligomers through its leucine-zipper motif. This kinase can phosphorylate and activate MAPK8/JNK, MAP2K7/MKK7, which suggests a role in the JNK signaling pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,659,923 (GRCm39) Y790H probably damaging Het
Bend3 A C 10: 43,369,667 (GRCm39) S7R probably benign Het
Ccdc106 A G 7: 5,063,325 (GRCm39) T277A probably damaging Het
Ccdc162 G A 10: 41,431,997 (GRCm39) A1832V probably damaging Het
Ccser1 A G 6: 61,288,851 (GRCm39) E338G probably benign Het
Cd86 CA CAA 16: 36,426,917 (GRCm39) probably null Het
Cecr2 T C 6: 120,739,490 (GRCm39) S1406P probably benign Het
Cep290 A G 10: 100,382,360 (GRCm39) T208A probably damaging Het
Cep85l A C 10: 53,172,351 (GRCm39) C569W probably damaging Het
Ces5a G A 8: 94,226,154 (GRCm39) T527I probably benign Het
Clca3a2 T A 3: 144,796,608 (GRCm39) I200F probably damaging Het
Cmas G A 6: 142,716,312 (GRCm39) D251N probably damaging Het
Ctcfl G T 2: 172,960,268 (GRCm39) A105E probably benign Het
Dclk2 C T 3: 86,700,566 (GRCm39) R638H probably damaging Het
Dctn6 A T 8: 34,557,962 (GRCm39) I170N probably damaging Het
Dnah2 T C 11: 69,321,920 (GRCm39) Y3800C probably damaging Het
Dsg2 G A 18: 20,724,988 (GRCm39) V465I possibly damaging Het
Dzip1 T C 14: 119,123,058 (GRCm39) T646A probably benign Het
Etv4 T A 11: 101,675,151 (GRCm39) probably null Het
Exoc3l2 T C 7: 19,218,628 (GRCm39) V549A unknown Het
Ficd G T 5: 113,876,880 (GRCm39) A352S probably damaging Het
Fry T G 5: 150,390,251 (GRCm39) I179S Het
Galntl5 A G 5: 25,400,298 (GRCm39) H109R probably benign Het
Garem1 C A 18: 21,281,811 (GRCm39) G182W probably damaging Het
Gm5916 A T 9: 36,032,285 (GRCm39) Y50N possibly damaging Het
Gtf2h2 A T 13: 100,615,709 (GRCm39) F271I probably benign Het
Hivep2 G T 10: 14,004,845 (GRCm39) S481I probably benign Het
Homez T A 14: 55,094,877 (GRCm39) Q277L probably damaging Het
Hoxb4 C A 11: 96,210,722 (GRCm39) probably null Het
Igll1 A G 16: 16,678,957 (GRCm39) S118P probably damaging Het
Ikzf2 A C 1: 69,617,212 (GRCm39) probably null Het
Kif5b A G 18: 6,225,340 (GRCm39) V230A probably damaging Het
Ldlr T A 9: 21,657,040 (GRCm39) V719E probably benign Het
Lsm7 G A 10: 80,689,565 (GRCm39) R66W possibly damaging Het
Mmrn1 A G 6: 60,953,098 (GRCm39) K460E probably damaging Het
Myh10 A C 11: 68,681,515 (GRCm39) N1061H probably damaging Het
Nepn A G 10: 52,277,089 (GRCm39) Q275R probably benign Het
Noc3l A T 19: 38,800,800 (GRCm39) D227E probably benign Het
Nploc4 G T 11: 120,319,376 (GRCm39) S61R probably benign Het
Nr4a2 T C 2: 57,002,381 (GRCm39) Y24C probably damaging Het
Nup160 T A 2: 90,553,699 (GRCm39) I1143N probably damaging Het
Or14a256 G T 7: 86,264,873 (GRCm39) H327N probably benign Het
Or4a15 A T 2: 89,192,838 (GRCm39) Y312N probably benign Het
Or8c17 T A 9: 38,180,004 (GRCm39) M57K probably damaging Het
Or8h7 A G 2: 86,720,956 (GRCm39) S188P probably damaging Het
Papola T A 12: 105,775,604 (GRCm39) C204S probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pgap1 A T 1: 54,532,366 (GRCm39) probably null Het
Pitrm1 A G 13: 6,606,633 (GRCm39) H229R probably damaging Het
Plcl1 A G 1: 55,737,377 (GRCm39) Q906R probably benign Het
Ppfia3 T C 7: 44,991,167 (GRCm39) N1018S probably benign Het
Pramel24 T A 4: 143,452,849 (GRCm39) D93E probably benign Het
Prkd1 A G 12: 50,435,125 (GRCm39) V534A possibly damaging Het
Pygm A T 19: 6,435,926 (GRCm39) I126F probably benign Het
Rag1 T C 2: 101,472,415 (GRCm39) Y909C probably damaging Het
Rasgrf2 G A 13: 92,032,637 (GRCm39) Q560* probably null Het
Rbp3 A T 14: 33,684,540 (GRCm39) I1190F possibly damaging Het
Reln T C 5: 22,183,921 (GRCm39) K1693E probably benign Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Rsph3a A G 17: 8,165,002 (GRCm39) T121A probably benign Het
Rufy3 A G 5: 88,762,806 (GRCm39) N112S possibly damaging Het
Ryr3 G A 2: 112,502,591 (GRCm39) Q3548* probably null Het
Sardh A T 2: 27,108,824 (GRCm39) V637D probably benign Het
Spata16 T C 3: 26,722,016 (GRCm39) V179A probably benign Het
Spopfm2 T C 3: 94,083,667 (GRCm39) E48G probably benign Het
Tbc1d30 G A 10: 121,124,870 (GRCm39) T319I probably damaging Het
Tlr2 T A 3: 83,744,913 (GRCm39) Q390L possibly damaging Het
Tmem53 C T 4: 117,109,237 (GRCm39) probably null Het
Vmn1r113 T A 7: 20,521,370 (GRCm39) I54N probably damaging Het
Vmn1r223 A C 13: 23,434,036 (GRCm39) Y210S probably damaging Het
Zbbx A T 3: 74,947,205 (GRCm39) H670Q probably benign Het
Other mutations in Map3k13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Map3k13 APN 16 21,740,514 (GRCm39) missense probably benign 0.00
IGL01092:Map3k13 APN 16 21,746,766 (GRCm39) missense probably damaging 0.97
IGL01958:Map3k13 APN 16 21,710,873 (GRCm39) missense probably benign
IGL02444:Map3k13 APN 16 21,732,982 (GRCm39) missense probably benign 0.19
IGL02503:Map3k13 APN 16 21,727,454 (GRCm39) missense possibly damaging 0.50
IGL02712:Map3k13 APN 16 21,724,005 (GRCm39) missense probably damaging 0.99
IGL03342:Map3k13 APN 16 21,710,981 (GRCm39) missense possibly damaging 0.94
R0086:Map3k13 UTSW 16 21,732,975 (GRCm39) missense probably damaging 0.98
R0124:Map3k13 UTSW 16 21,722,506 (GRCm39) missense possibly damaging 0.95
R0281:Map3k13 UTSW 16 21,732,907 (GRCm39) missense probably damaging 1.00
R0308:Map3k13 UTSW 16 21,710,738 (GRCm39) missense probably benign
R0601:Map3k13 UTSW 16 21,723,999 (GRCm39) missense possibly damaging 0.95
R0669:Map3k13 UTSW 16 21,725,274 (GRCm39) missense probably benign 0.03
R0918:Map3k13 UTSW 16 21,744,990 (GRCm39) missense probably damaging 1.00
R1641:Map3k13 UTSW 16 21,722,542 (GRCm39) missense probably damaging 1.00
R1838:Map3k13 UTSW 16 21,732,939 (GRCm39) missense possibly damaging 0.92
R1891:Map3k13 UTSW 16 21,729,836 (GRCm39) missense probably damaging 1.00
R2125:Map3k13 UTSW 16 21,710,894 (GRCm39) missense probably benign 0.01
R2332:Map3k13 UTSW 16 21,717,427 (GRCm39) splice site probably null
R2361:Map3k13 UTSW 16 21,725,286 (GRCm39) missense probably benign 0.05
R4395:Map3k13 UTSW 16 21,717,321 (GRCm39) missense possibly damaging 0.49
R4505:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4506:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4521:Map3k13 UTSW 16 21,724,525 (GRCm39) missense possibly damaging 0.94
R4753:Map3k13 UTSW 16 21,710,752 (GRCm39) missense probably benign
R4952:Map3k13 UTSW 16 21,729,769 (GRCm39) missense probably benign 0.15
R5035:Map3k13 UTSW 16 21,740,421 (GRCm39) missense probably benign 0.03
R5327:Map3k13 UTSW 16 21,740,397 (GRCm39) missense possibly damaging 0.89
R5784:Map3k13 UTSW 16 21,717,391 (GRCm39) missense possibly damaging 0.68
R5831:Map3k13 UTSW 16 21,746,798 (GRCm39) makesense probably null
R5996:Map3k13 UTSW 16 21,723,995 (GRCm39) missense possibly damaging 0.95
R6007:Map3k13 UTSW 16 21,723,933 (GRCm39) missense possibly damaging 0.95
R6546:Map3k13 UTSW 16 21,740,527 (GRCm39) missense probably benign 0.15
R6620:Map3k13 UTSW 16 21,711,061 (GRCm39) missense possibly damaging 0.62
R6683:Map3k13 UTSW 16 21,711,062 (GRCm39) missense probably benign 0.32
R6692:Map3k13 UTSW 16 21,723,987 (GRCm39) missense possibly damaging 0.66
R6695:Map3k13 UTSW 16 21,741,028 (GRCm39) missense probably benign 0.10
R6743:Map3k13 UTSW 16 21,711,173 (GRCm39) missense probably damaging 0.98
R6822:Map3k13 UTSW 16 21,741,013 (GRCm39) missense probably benign 0.00
R6965:Map3k13 UTSW 16 21,740,900 (GRCm39) missense probably benign
R7149:Map3k13 UTSW 16 21,744,187 (GRCm39) missense probably benign 0.04
R7174:Map3k13 UTSW 16 21,745,006 (GRCm39) missense probably damaging 1.00
R7400:Map3k13 UTSW 16 21,741,072 (GRCm39) missense probably damaging 1.00
R7733:Map3k13 UTSW 16 21,740,436 (GRCm39) missense probably damaging 1.00
R7848:Map3k13 UTSW 16 21,724,621 (GRCm39) missense probably damaging 0.98
R7871:Map3k13 UTSW 16 21,740,346 (GRCm39) missense probably benign 0.09
R7876:Map3k13 UTSW 16 21,741,069 (GRCm39) missense probably benign 0.00
R8002:Map3k13 UTSW 16 21,723,878 (GRCm39) missense probably benign 0.05
R8089:Map3k13 UTSW 16 21,722,567 (GRCm39) missense possibly damaging 0.48
R8341:Map3k13 UTSW 16 21,740,334 (GRCm39) nonsense probably null
R8738:Map3k13 UTSW 16 21,745,008 (GRCm39) missense probably damaging 1.00
R8940:Map3k13 UTSW 16 21,727,454 (GRCm39) missense possibly damaging 0.50
R8949:Map3k13 UTSW 16 21,723,882 (GRCm39) missense probably benign 0.05
R9391:Map3k13 UTSW 16 21,740,665 (GRCm39) missense probably benign 0.00
R9749:Map3k13 UTSW 16 21,740,581 (GRCm39) missense probably benign 0.00
R9802:Map3k13 UTSW 16 21,740,518 (GRCm39) missense possibly damaging 0.85
Z1176:Map3k13 UTSW 16 21,723,912 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTGGTGGACGAAATGAG -3'
(R):5'- CTGCTGCAGCTTGTAATCAGTG -3'

Sequencing Primer
(F):5'- GCTTGCAGCTATGGGGAAC -3'
(R):5'- CAGTGGAATATGCCTTCCCAATG -3'
Posted On 2019-06-26