Incidental Mutation 'R7256:Garem1'
ID 564306
Institutional Source Beutler Lab
Gene Symbol Garem1
Ensembl Gene ENSMUSG00000042680
Gene Name GRB2 associated regulator of MAPK1 subtype 1
Synonyms Garem, Fam59a, LOC381126
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock # R7256 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 21127201-21300138 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 21148754 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Tryptophan at position 182 (G182W)
Ref Sequence ENSEMBL: ENSMUSP00000048914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049260]
AlphaFold Q3UFT3
Predicted Effect probably damaging
Transcript: ENSMUST00000049260
AA Change: G182W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048914
Gene: ENSMUSG00000042680
AA Change: G182W

DomainStartEndE-ValueType
Pfam:CABIT 32 318 3.4e-79 PFAM
low complexity region 484 499 N/A INTRINSIC
low complexity region 512 518 N/A INTRINSIC
PDB:2DKZ|A 795 874 2e-40 PDB
Blast:SAM 808 875 2e-36 BLAST
SCOP:d1kw4a_ 812 873 4e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein which functions in the epidermal growth factor (EGF) receptor-mediated signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,863,035 Y790H probably damaging Het
Bend3 A C 10: 43,493,671 S7R probably benign Het
Ccdc106 A G 7: 5,060,326 T277A probably damaging Het
Ccdc162 G A 10: 41,556,001 A1832V probably damaging Het
Ccser1 A G 6: 61,311,867 E338G probably benign Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cecr2 T C 6: 120,762,529 S1406P probably benign Het
Cep290 A G 10: 100,546,498 T208A probably damaging Het
Cep85l A C 10: 53,296,255 C569W probably damaging Het
Ces5a G A 8: 93,499,526 T527I probably benign Het
Clca2 T A 3: 145,090,847 I200F probably damaging Het
Cmas G A 6: 142,770,586 D251N probably damaging Het
Ctcfl G T 2: 173,118,475 A105E probably benign Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
Dctn6 A T 8: 34,090,808 I170N probably damaging Het
Dnah2 T C 11: 69,431,094 Y3800C probably damaging Het
Dsg2 G A 18: 20,591,931 V465I possibly damaging Het
Dzip1 T C 14: 118,885,646 T646A probably benign Het
Etv4 T A 11: 101,784,325 probably null Het
Exoc3l2 T C 7: 19,484,703 V549A unknown Het
Ficd G T 5: 113,738,819 A352S probably damaging Het
Fry T G 5: 150,466,786 I179S Het
Galntl5 A G 5: 25,195,300 H109R probably benign Het
Gm10696 T C 3: 94,176,360 E48G probably benign Het
Gm13078 T A 4: 143,726,279 D93E probably benign Het
Gm5916 A T 9: 36,120,989 Y50N possibly damaging Het
Gtf2h2 A T 13: 100,479,201 F271I probably benign Het
Hivep2 G T 10: 14,129,101 S481I probably benign Het
Homez T A 14: 54,857,420 Q277L probably damaging Het
Hoxb4 C A 11: 96,319,896 probably null Het
Igll1 A G 16: 16,861,093 S118P probably damaging Het
Ikzf2 A C 1: 69,578,053 probably null Het
Kif5b A G 18: 6,225,340 V230A probably damaging Het
Ldlr T A 9: 21,745,744 V719E probably benign Het
Lsm7 G A 10: 80,853,731 R66W possibly damaging Het
Map3k13 T A 16: 21,892,238 D90E probably benign Het
Mmrn1 A G 6: 60,976,114 K460E probably damaging Het
Myh10 A C 11: 68,790,689 N1061H probably damaging Het
Nepn A G 10: 52,400,993 Q275R probably benign Het
Noc3l A T 19: 38,812,356 D227E probably benign Het
Nploc4 G T 11: 120,428,550 S61R probably benign Het
Nr4a2 T C 2: 57,112,369 Y24C probably damaging Het
Nup160 T A 2: 90,723,355 I1143N probably damaging Het
Olfr1097 A G 2: 86,890,612 S188P probably damaging Het
Olfr1234 A T 2: 89,362,494 Y312N probably benign Het
Olfr294 G T 7: 86,615,665 H327N probably benign Het
Olfr895 T A 9: 38,268,708 M57K probably damaging Het
Papola T A 12: 105,809,345 C204S probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pgap1 A T 1: 54,493,207 probably null Het
Pitrm1 A G 13: 6,556,597 H229R probably damaging Het
Plcl1 A G 1: 55,698,218 Q906R probably benign Het
Ppfia3 T C 7: 45,341,743 N1018S probably benign Het
Prkd1 A G 12: 50,388,342 V534A possibly damaging Het
Pygm A T 19: 6,385,896 I126F probably benign Het
Rag1 T C 2: 101,642,070 Y909C probably damaging Het
Rasgrf2 G A 13: 91,884,518 Q560* probably null Het
Rbp3 A T 14: 33,962,583 I1190F possibly damaging Het
Reln T C 5: 21,978,923 K1693E probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rsph3a A G 17: 7,946,170 T121A probably benign Het
Rufy3 A G 5: 88,614,947 N112S possibly damaging Het
Ryr3 G A 2: 112,672,246 Q3548* probably null Het
Sardh A T 2: 27,218,812 V637D probably benign Het
Spata16 T C 3: 26,667,867 V179A probably benign Het
Tbc1d30 G A 10: 121,288,965 T319I probably damaging Het
Tlr2 T A 3: 83,837,606 Q390L possibly damaging Het
Tmem53 C T 4: 117,252,040 probably null Het
Vmn1r113 T A 7: 20,787,445 I54N probably damaging Het
Vmn1r223 A C 13: 23,249,866 Y210S probably damaging Het
Zbbx A T 3: 75,039,898 H670Q probably benign Het
Other mutations in Garem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Garem1 APN 18 21148657 missense probably damaging 1.00
IGL01588:Garem1 APN 18 21129797 missense probably damaging 0.99
IGL02171:Garem1 APN 18 21129241 missense probably damaging 0.98
IGL02270:Garem1 APN 18 21148450 missense probably damaging 1.00
IGL03149:Garem1 APN 18 21131466 missense probably damaging 1.00
R0136:Garem1 UTSW 18 21129991 missense probably damaging 0.96
R0285:Garem1 UTSW 18 21129612 missense probably benign
R0361:Garem1 UTSW 18 21299744 nonsense probably null
R1068:Garem1 UTSW 18 21168755 missense probably benign 0.00
R1537:Garem1 UTSW 18 21168874 splice site probably null
R1726:Garem1 UTSW 18 21148262 missense probably damaging 0.99
R1826:Garem1 UTSW 18 21129452 missense probably benign 0.00
R2140:Garem1 UTSW 18 21129374 missense probably damaging 1.00
R3714:Garem1 UTSW 18 21148890 missense probably damaging 1.00
R3937:Garem1 UTSW 18 21148806 nonsense probably null
R4362:Garem1 UTSW 18 21236115 missense possibly damaging 0.62
R4441:Garem1 UTSW 18 21168750 missense possibly damaging 0.92
R4747:Garem1 UTSW 18 21129943 missense probably benign
R4814:Garem1 UTSW 18 21148116 missense probably damaging 1.00
R4831:Garem1 UTSW 18 21129768 missense probably benign 0.01
R4838:Garem1 UTSW 18 21147893 missense probably benign 0.00
R5805:Garem1 UTSW 18 21148435 missense probably benign 0.04
R5963:Garem1 UTSW 18 21129430 missense probably benign 0.45
R5982:Garem1 UTSW 18 21148351 missense possibly damaging 0.64
R6134:Garem1 UTSW 18 21129824 missense probably benign 0.00
R6242:Garem1 UTSW 18 21129172 missense possibly damaging 0.72
R6453:Garem1 UTSW 18 21148739 missense probably damaging 0.99
R6485:Garem1 UTSW 18 21129837 missense probably benign 0.00
R6596:Garem1 UTSW 18 21148739 missense probably damaging 0.99
R6662:Garem1 UTSW 18 21148247 missense probably benign 0.45
R6883:Garem1 UTSW 18 21129712 missense probably benign
R6937:Garem1 UTSW 18 21147770 missense probably benign 0.00
R7027:Garem1 UTSW 18 21129994 missense probably benign
R7534:Garem1 UTSW 18 21299916 start gained probably benign
R7620:Garem1 UTSW 18 21129841 missense probably benign
R7869:Garem1 UTSW 18 21299700 missense probably damaging 1.00
R7963:Garem1 UTSW 18 21148787 missense probably damaging 0.98
R8058:Garem1 UTSW 18 21148564 missense probably damaging 1.00
R8953:Garem1 UTSW 18 21131331 critical splice donor site probably null
R9273:Garem1 UTSW 18 21148217 missense probably damaging 0.99
R9411:Garem1 UTSW 18 21236000 critical splice donor site probably null
R9475:Garem1 UTSW 18 21148313 missense probably benign 0.00
Z1176:Garem1 UTSW 18 21129792 missense probably damaging 1.00
Z1176:Garem1 UTSW 18 21148325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTCACATTCACGGGGAG -3'
(R):5'- GTTTGCTTCACTAATGTGGAATTCG -3'

Sequencing Primer
(F):5'- GAGTCGAGTCTTCTCCACGATG -3'
(R):5'- CACTAATGTGGAATTCGGTTTATCG -3'
Posted On 2019-06-26