Incidental Mutation 'R7256:Garem1'
ID 564306
Institutional Source Beutler Lab
Gene Symbol Garem1
Ensembl Gene ENSMUSG00000042680
Gene Name GRB2 associated regulator of MAPK1 subtype 1
Synonyms LOC381126, Garem, Fam59a
MMRRC Submission 045317-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.154) question?
Stock # R7256 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 21260399-21433196 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 21281811 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Tryptophan at position 182 (G182W)
Ref Sequence ENSEMBL: ENSMUSP00000048914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049260]
AlphaFold Q3UFT3
Predicted Effect probably damaging
Transcript: ENSMUST00000049260
AA Change: G182W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048914
Gene: ENSMUSG00000042680
AA Change: G182W

DomainStartEndE-ValueType
Pfam:CABIT 32 318 3.4e-79 PFAM
low complexity region 484 499 N/A INTRINSIC
low complexity region 512 518 N/A INTRINSIC
PDB:2DKZ|A 795 874 2e-40 PDB
Blast:SAM 808 875 2e-36 BLAST
SCOP:d1kw4a_ 812 873 4e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein which functions in the epidermal growth factor (EGF) receptor-mediated signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,659,923 (GRCm39) Y790H probably damaging Het
Bend3 A C 10: 43,369,667 (GRCm39) S7R probably benign Het
Ccdc106 A G 7: 5,063,325 (GRCm39) T277A probably damaging Het
Ccdc162 G A 10: 41,431,997 (GRCm39) A1832V probably damaging Het
Ccser1 A G 6: 61,288,851 (GRCm39) E338G probably benign Het
Cd86 CA CAA 16: 36,426,917 (GRCm39) probably null Het
Cecr2 T C 6: 120,739,490 (GRCm39) S1406P probably benign Het
Cep290 A G 10: 100,382,360 (GRCm39) T208A probably damaging Het
Cep85l A C 10: 53,172,351 (GRCm39) C569W probably damaging Het
Ces5a G A 8: 94,226,154 (GRCm39) T527I probably benign Het
Clca3a2 T A 3: 144,796,608 (GRCm39) I200F probably damaging Het
Cmas G A 6: 142,716,312 (GRCm39) D251N probably damaging Het
Ctcfl G T 2: 172,960,268 (GRCm39) A105E probably benign Het
Dclk2 C T 3: 86,700,566 (GRCm39) R638H probably damaging Het
Dctn6 A T 8: 34,557,962 (GRCm39) I170N probably damaging Het
Dnah2 T C 11: 69,321,920 (GRCm39) Y3800C probably damaging Het
Dsg2 G A 18: 20,724,988 (GRCm39) V465I possibly damaging Het
Dzip1 T C 14: 119,123,058 (GRCm39) T646A probably benign Het
Etv4 T A 11: 101,675,151 (GRCm39) probably null Het
Exoc3l2 T C 7: 19,218,628 (GRCm39) V549A unknown Het
Ficd G T 5: 113,876,880 (GRCm39) A352S probably damaging Het
Fry T G 5: 150,390,251 (GRCm39) I179S Het
Galntl5 A G 5: 25,400,298 (GRCm39) H109R probably benign Het
Gm5916 A T 9: 36,032,285 (GRCm39) Y50N possibly damaging Het
Gtf2h2 A T 13: 100,615,709 (GRCm39) F271I probably benign Het
Hivep2 G T 10: 14,004,845 (GRCm39) S481I probably benign Het
Homez T A 14: 55,094,877 (GRCm39) Q277L probably damaging Het
Hoxb4 C A 11: 96,210,722 (GRCm39) probably null Het
Igll1 A G 16: 16,678,957 (GRCm39) S118P probably damaging Het
Ikzf2 A C 1: 69,617,212 (GRCm39) probably null Het
Kif5b A G 18: 6,225,340 (GRCm39) V230A probably damaging Het
Ldlr T A 9: 21,657,040 (GRCm39) V719E probably benign Het
Lsm7 G A 10: 80,689,565 (GRCm39) R66W possibly damaging Het
Map3k13 T A 16: 21,710,988 (GRCm39) D90E probably benign Het
Mmrn1 A G 6: 60,953,098 (GRCm39) K460E probably damaging Het
Myh10 A C 11: 68,681,515 (GRCm39) N1061H probably damaging Het
Nepn A G 10: 52,277,089 (GRCm39) Q275R probably benign Het
Noc3l A T 19: 38,800,800 (GRCm39) D227E probably benign Het
Nploc4 G T 11: 120,319,376 (GRCm39) S61R probably benign Het
Nr4a2 T C 2: 57,002,381 (GRCm39) Y24C probably damaging Het
Nup160 T A 2: 90,553,699 (GRCm39) I1143N probably damaging Het
Or14a256 G T 7: 86,264,873 (GRCm39) H327N probably benign Het
Or4a15 A T 2: 89,192,838 (GRCm39) Y312N probably benign Het
Or8c17 T A 9: 38,180,004 (GRCm39) M57K probably damaging Het
Or8h7 A G 2: 86,720,956 (GRCm39) S188P probably damaging Het
Papola T A 12: 105,775,604 (GRCm39) C204S probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pgap1 A T 1: 54,532,366 (GRCm39) probably null Het
Pitrm1 A G 13: 6,606,633 (GRCm39) H229R probably damaging Het
Plcl1 A G 1: 55,737,377 (GRCm39) Q906R probably benign Het
Ppfia3 T C 7: 44,991,167 (GRCm39) N1018S probably benign Het
Pramel24 T A 4: 143,452,849 (GRCm39) D93E probably benign Het
Prkd1 A G 12: 50,435,125 (GRCm39) V534A possibly damaging Het
Pygm A T 19: 6,435,926 (GRCm39) I126F probably benign Het
Rag1 T C 2: 101,472,415 (GRCm39) Y909C probably damaging Het
Rasgrf2 G A 13: 92,032,637 (GRCm39) Q560* probably null Het
Rbp3 A T 14: 33,684,540 (GRCm39) I1190F possibly damaging Het
Reln T C 5: 22,183,921 (GRCm39) K1693E probably benign Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Rsph3a A G 17: 8,165,002 (GRCm39) T121A probably benign Het
Rufy3 A G 5: 88,762,806 (GRCm39) N112S possibly damaging Het
Ryr3 G A 2: 112,502,591 (GRCm39) Q3548* probably null Het
Sardh A T 2: 27,108,824 (GRCm39) V637D probably benign Het
Spata16 T C 3: 26,722,016 (GRCm39) V179A probably benign Het
Spopfm2 T C 3: 94,083,667 (GRCm39) E48G probably benign Het
Tbc1d30 G A 10: 121,124,870 (GRCm39) T319I probably damaging Het
Tlr2 T A 3: 83,744,913 (GRCm39) Q390L possibly damaging Het
Tmem53 C T 4: 117,109,237 (GRCm39) probably null Het
Vmn1r113 T A 7: 20,521,370 (GRCm39) I54N probably damaging Het
Vmn1r223 A C 13: 23,434,036 (GRCm39) Y210S probably damaging Het
Zbbx A T 3: 74,947,205 (GRCm39) H670Q probably benign Het
Other mutations in Garem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Garem1 APN 18 21,281,714 (GRCm39) missense probably damaging 1.00
IGL01588:Garem1 APN 18 21,262,854 (GRCm39) missense probably damaging 0.99
IGL02171:Garem1 APN 18 21,262,298 (GRCm39) missense probably damaging 0.98
IGL02270:Garem1 APN 18 21,281,507 (GRCm39) missense probably damaging 1.00
IGL03149:Garem1 APN 18 21,264,523 (GRCm39) missense probably damaging 1.00
R0136:Garem1 UTSW 18 21,263,048 (GRCm39) missense probably damaging 0.96
R0285:Garem1 UTSW 18 21,262,669 (GRCm39) missense probably benign
R0361:Garem1 UTSW 18 21,432,801 (GRCm39) nonsense probably null
R1068:Garem1 UTSW 18 21,301,812 (GRCm39) missense probably benign 0.00
R1537:Garem1 UTSW 18 21,301,931 (GRCm39) splice site probably null
R1726:Garem1 UTSW 18 21,281,319 (GRCm39) missense probably damaging 0.99
R1826:Garem1 UTSW 18 21,262,509 (GRCm39) missense probably benign 0.00
R2140:Garem1 UTSW 18 21,262,431 (GRCm39) missense probably damaging 1.00
R3714:Garem1 UTSW 18 21,281,947 (GRCm39) missense probably damaging 1.00
R3937:Garem1 UTSW 18 21,281,863 (GRCm39) nonsense probably null
R4362:Garem1 UTSW 18 21,369,172 (GRCm39) missense possibly damaging 0.62
R4441:Garem1 UTSW 18 21,301,807 (GRCm39) missense possibly damaging 0.92
R4747:Garem1 UTSW 18 21,263,000 (GRCm39) missense probably benign
R4814:Garem1 UTSW 18 21,281,173 (GRCm39) missense probably damaging 1.00
R4831:Garem1 UTSW 18 21,262,825 (GRCm39) missense probably benign 0.01
R4838:Garem1 UTSW 18 21,280,950 (GRCm39) missense probably benign 0.00
R5805:Garem1 UTSW 18 21,281,492 (GRCm39) missense probably benign 0.04
R5963:Garem1 UTSW 18 21,262,487 (GRCm39) missense probably benign 0.45
R5982:Garem1 UTSW 18 21,281,408 (GRCm39) missense possibly damaging 0.64
R6134:Garem1 UTSW 18 21,262,881 (GRCm39) missense probably benign 0.00
R6242:Garem1 UTSW 18 21,262,229 (GRCm39) missense possibly damaging 0.72
R6453:Garem1 UTSW 18 21,281,796 (GRCm39) missense probably damaging 0.99
R6485:Garem1 UTSW 18 21,262,894 (GRCm39) missense probably benign 0.00
R6596:Garem1 UTSW 18 21,281,796 (GRCm39) missense probably damaging 0.99
R6662:Garem1 UTSW 18 21,281,304 (GRCm39) missense probably benign 0.45
R6883:Garem1 UTSW 18 21,262,769 (GRCm39) missense probably benign
R6937:Garem1 UTSW 18 21,280,827 (GRCm39) missense probably benign 0.00
R7027:Garem1 UTSW 18 21,263,051 (GRCm39) missense probably benign
R7534:Garem1 UTSW 18 21,432,973 (GRCm39) start gained probably benign
R7620:Garem1 UTSW 18 21,262,898 (GRCm39) missense probably benign
R7869:Garem1 UTSW 18 21,432,757 (GRCm39) missense probably damaging 1.00
R7963:Garem1 UTSW 18 21,281,844 (GRCm39) missense probably damaging 0.98
R8058:Garem1 UTSW 18 21,281,621 (GRCm39) missense probably damaging 1.00
R8953:Garem1 UTSW 18 21,264,388 (GRCm39) critical splice donor site probably null
R9273:Garem1 UTSW 18 21,281,274 (GRCm39) missense probably damaging 0.99
R9411:Garem1 UTSW 18 21,369,057 (GRCm39) critical splice donor site probably null
R9475:Garem1 UTSW 18 21,281,370 (GRCm39) missense probably benign 0.00
R9789:Garem1 UTSW 18 21,262,985 (GRCm39) missense possibly damaging 0.81
Z1176:Garem1 UTSW 18 21,281,382 (GRCm39) missense probably damaging 1.00
Z1176:Garem1 UTSW 18 21,262,849 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTCACATTCACGGGGAG -3'
(R):5'- GTTTGCTTCACTAATGTGGAATTCG -3'

Sequencing Primer
(F):5'- GAGTCGAGTCTTCTCCACGATG -3'
(R):5'- CACTAATGTGGAATTCGGTTTATCG -3'
Posted On 2019-06-26