Mutagenetix > Incidental Mutation

Incidental Mutation 'R7257:Pla2r1'

564314

Institutional Source

Beutler Lab

Gene Symbol

Pla2r1

Ensembl Gene

ENSMUSG00000054580

Gene Name

phospholipase A2 receptor 1

Synonyms

M-type receptor, Pla2g1br, PLA2-I receptor

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7257 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60417543-60553308 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 60427625 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000108144 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112525]

AlphaFold

Q62028

Predicted Effect

probably null
Transcript: ENSMUST00000112525

SMART Domains

Protein: ENSMUSP00000108144
Gene: ENSMUSG00000054580

Domain	Start	End	E-Value	Type
low complexity region	35	62	N/A	INTRINSIC
RICIN	77	189	2.98e-16	SMART
FN2	209	257	1.17e-25	SMART
CLECT	267	392	7.66e-30	SMART
CLECT	415	539	1.88e-29	SMART
CLECT	552	679	5.42e-21	SMART
CLECT	699	832	3.58e-21	SMART
CLECT	847	973	7.55e-20	SMART
CLECT	992	1131	5.05e-30	SMART
CLECT	1148	1267	4.72e-21	SMART
CLECT	1281	1412	1.44e-25	SMART
transmembrane domain	1432	1454	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a phospholipase A2 receptor. The encoded protein likely exists as both a transmembrane form and a soluble form. The transmembrane receptor may play a role in clearance of phospholipase A2, thereby inhibiting its action. Polymorphisms at this locus have been associated with susceptibility to idiopathic membranous nephropathy. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous null mice are viable and fertile with no overt abnormalities. These mice are more resistant to toxic effects of lipopolysaccharide than controls, suggesting a role for this gene in the progression of endotoxic shock. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb1	A	T	6: 88,839,452	V120E	probably benign	Het
Acot11	G	A	4: 106,758,402	T284M	probably damaging	Het
Adk	G	T	14: 21,052,671	K11N	probably damaging	Het
Akr1c14	T	A	13: 4,088,966	N316K	probably benign	Het
AL732309.1	A	T	2: 25,245,839	V121D	probably benign	Het
Amh	C	A	10: 80,806,653	Q257K	probably benign	Het
Antxrl	T	G	14: 34,065,849	H276Q	probably benign	Het
Atp5o	G	A	16: 91,926,867	T105M	probably damaging	Het
Atp5s	T	C	12: 69,741,669	I114T	probably damaging	Het
Atxn2	T	G	5: 121,785,817	N734K	possibly damaging	Het
B3gat3	T	A	19: 8,925,738	V153D	probably benign	Het
Brd2	A	G	17: 34,113,822	V528A	probably damaging	Het
Camk2g	T	C	14: 20,747,839	S335G	probably benign	Het
Cbln2	T	A	18: 86,716,734	W211R	probably damaging	Het
Cry2	A	T	2: 92,412,981	I505N	possibly damaging	Het
Ddx55	T	A	5: 124,560,721	C249S	possibly damaging	Het
Dglucy	A	G	12: 100,842,738	T232A	probably damaging	Het
Dhx32	A	G	7: 133,759,477	Y76H	probably benign	Het
Dock7	T	A	4: 98,973,412	N1356I	unknown	Het
Dock8	T	A	19: 25,127,085	N710K	probably benign	Het
Dync1i2	T	A	2: 71,249,356	N391K	possibly damaging	Het
Ect2	A	G	3: 27,138,535	S420P	probably damaging	Het
Efcab5	T	A	11: 77,137,779	E242V	probably damaging	Het
Fam83g	T	A	11: 61,684,753	Y74N	probably damaging	Het
Fbxo34	T	A	14: 47,500,872		probably null	Het
Flt4	A	G	11: 49,626,009	T208A	probably benign	Het
Fxyd5	T	A	7: 31,035,151	H183L	unknown	Het
Gpr150	T	G	13: 76,056,466	D120A	probably benign	Het
Grm7	A	G	6: 110,646,118	Y84C	probably damaging	Het
Ighmbp2	A	G	19: 3,266,405	S562P	probably damaging	Het
Itga7	A	G	10: 128,944,413	Y530C	possibly damaging	Het
Itpr3	T	A	17: 27,118,561	D2448E	probably benign	Het
Mmp17	C	A	5: 129,595,633	H216Q	probably benign	Het
Mns1	C	T	9: 72,452,815	R416W	probably damaging	Het
Mog	A	G	17: 37,023,127	S25P	unknown	Het
Myh2	A	G	11: 67,181,150	K568R	possibly damaging	Het
Myh7	A	T	14: 54,972,490		probably null	Het
Mymk	A	T	2: 27,067,368	W79R	probably damaging	Het
Ncoa4	T	G	14: 32,177,369	L623R	probably damaging	Het
Oca2	G	A	7: 56,279,538		probably benign	Het
Odam	A	C	5: 87,887,545	S123R	probably benign	Het
Olfr1155	A	G	2: 87,943,571	F19S	probably damaging	Het
Olfr263	A	G	13: 21,133,257	T161A	probably benign	Het
Olfr292	T	A	7: 86,694,804	M116K	probably damaging	Het
Olfr583	T	C	7: 103,051,630	F111L	probably benign	Het
Olfr765	C	T	10: 129,046,455	V203M	probably benign	Het
Olfr816	T	A	10: 129,912,287		probably benign	Het
Ovch2	C	T	7: 107,794,433	C162Y	probably damaging	Het
Padi1	C	A	4: 140,829,471	G142C	probably damaging	Het
Pcdhga4	A	G	18: 37,687,398	I667V	probably damaging	Het
Pfas	A	T	11: 68,992,959	V624E	probably damaging	Het
Phb	A	T	11: 95,678,091	E184V	probably damaging	Het
Phlpp2	G	T	8: 109,940,188	M1116I	probably benign	Het
Pip5kl1	T	C	2: 32,580,431		probably null	Het
Pitpnm2	T	A	5: 124,125,356	I824F	possibly damaging	Het
Pla2g4c	G	A	7: 13,325,744	S2N	possibly damaging	Het
Pole2	T	C	12: 69,202,910	D521G	probably damaging	Het
Ptch1	T	C	13: 63,573,294	K54E	not run	Het
Rapgef2	A	T	3: 79,082,627	L931Q	probably damaging	Het
Rassf3	G	A	10: 121,413,019	Q206*	probably null	Het
Rnf123	T	A	9: 108,069,029	T316S	probably damaging	Het
Rnf138	T	A	18: 21,008,693		probably null	Het
Sept3	G	A	15: 82,289,213	A249T	probably damaging	Het
Slc35a4	A	T	18: 36,679,616	D3V	unknown	Het
Sltm	T	A	9: 70,543,965		probably null	Het
Smarca2	C	T	19: 26,654,464	Q560*	probably null	Het
Tcl1b1	A	T	12: 105,164,531	D91V	probably damaging	Het
Tirap	A	T	9: 35,189,034	V118E	probably damaging	Het
Tlr5	T	A	1: 182,974,233	Y367*	probably null	Het
Tmcc1	A	G	6: 116,107,338	F5L	probably benign	Het
Tnxb	A	G	17: 34,716,501	M2592V	probably benign	Het
Trim66	T	A	7: 109,460,244	E931V	probably damaging	Het
Ttn	A	G	2: 76,741,094	I26485T	probably damaging	Het
Veph1	C	A	3: 66,158,282	V455L	probably benign	Het
Vmn1r125	A	T	7: 21,272,825	H216L	probably damaging	Het
Wdr17	T	A	8: 54,632,487	E1200D	probably benign	Het
Zbtb37	T	A	1: 161,032,661	N25Y	probably damaging	Het

Other mutations in Pla2r1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Pla2r1	APN	2	60420425	missense	probably benign
IGL00886:Pla2r1	APN	2	60424324	missense	probably damaging	1.00
IGL00928:Pla2r1	APN	2	60535080	missense	probably damaging	0.99
IGL01361:Pla2r1	APN	2	60479470	missense	probably damaging	1.00
IGL01403:Pla2r1	APN	2	60424288	missense	probably damaging	0.99
IGL01475:Pla2r1	APN	2	60441081	splice site	probably benign
IGL01517:Pla2r1	APN	2	60504253	missense	probably damaging	1.00
IGL01646:Pla2r1	APN	2	60495364	missense	probably damaging	1.00
IGL02208:Pla2r1	APN	2	60428588	missense	possibly damaging	0.81
IGL02301:Pla2r1	APN	2	60452436	missense	probably benign	0.01
IGL02522:Pla2r1	APN	2	60428669	missense	probably benign	0.11
IGL02688:Pla2r1	APN	2	60455201	missense	probably damaging	1.00
IGL02822:Pla2r1	APN	2	60455173	missense	probably damaging	1.00
IGL02850:Pla2r1	APN	2	60502069	missense	probably benign	0.03
IGL03233:Pla2r1	APN	2	60428580	missense	possibly damaging	0.63
IGL03350:Pla2r1	APN	2	60455173	missense	probably damaging	1.00
IGL02980:Pla2r1	UTSW	2	60515046	missense	possibly damaging	0.77
R0105:Pla2r1	UTSW	2	60514981	missense	possibly damaging	0.89
R0105:Pla2r1	UTSW	2	60514981	missense	possibly damaging	0.89
R0387:Pla2r1	UTSW	2	60432601	missense	probably benign	0.03
R0522:Pla2r1	UTSW	2	60479515	missense	probably benign	0.01
R0550:Pla2r1	UTSW	2	60425350	critical splice donor site	probably null
R0718:Pla2r1	UTSW	2	60479530	missense	possibly damaging	0.55
R0906:Pla2r1	UTSW	2	60514947	missense	possibly damaging	0.79
R0945:Pla2r1	UTSW	2	60458410	missense	possibly damaging	0.89
R1229:Pla2r1	UTSW	2	60534762	missense	probably benign	0.09
R1397:Pla2r1	UTSW	2	60534762	missense	probably benign	0.09
R1667:Pla2r1	UTSW	2	60420257	missense	probably benign	0.00
R1668:Pla2r1	UTSW	2	60428646	missense	probably damaging	0.99
R1694:Pla2r1	UTSW	2	60441084	critical splice donor site	probably null
R1864:Pla2r1	UTSW	2	60428711	missense	probably benign	0.01
R2029:Pla2r1	UTSW	2	60431973	missense	probably damaging	0.99
R2035:Pla2r1	UTSW	2	60422736	missense	probably damaging	1.00
R2207:Pla2r1	UTSW	2	60458435	missense	probably damaging	1.00
R2429:Pla2r1	UTSW	2	60514968	missense	probably damaging	1.00
R3196:Pla2r1	UTSW	2	60522783	missense	probably damaging	1.00
R3522:Pla2r1	UTSW	2	60448906	missense	probably damaging	1.00
R3973:Pla2r1	UTSW	2	60448962	missense	probably benign	0.30
R4006:Pla2r1	UTSW	2	60522873	missense	probably damaging	1.00
R4091:Pla2r1	UTSW	2	60432593	missense	probably damaging	1.00
R4158:Pla2r1	UTSW	2	60422622	missense	probably damaging	0.97
R4160:Pla2r1	UTSW	2	60422622	missense	probably damaging	0.97
R4168:Pla2r1	UTSW	2	60497614	nonsense	probably null
R4541:Pla2r1	UTSW	2	60427738	missense	probably damaging	1.00
R4712:Pla2r1	UTSW	2	60428650	missense	probably damaging	1.00
R4797:Pla2r1	UTSW	2	60504180	missense	possibly damaging	0.47
R4884:Pla2r1	UTSW	2	60534984	missense	probably damaging	1.00
R4923:Pla2r1	UTSW	2	60422712	missense	probably benign	0.31
R5017:Pla2r1	UTSW	2	60522760	splice site	probably null
R5116:Pla2r1	UTSW	2	60448906	missense	probably damaging	1.00
R5641:Pla2r1	UTSW	2	60514984	missense	probably damaging	1.00
R5807:Pla2r1	UTSW	2	60428721	missense	possibly damaging	0.78
R5898:Pla2r1	UTSW	2	60422760	missense	probably damaging	1.00
R6241:Pla2r1	UTSW	2	60502199	splice site	probably null
R6923:Pla2r1	UTSW	2	60514966	missense	probably benign	0.11
R7020:Pla2r1	UTSW	2	60447399	missense	possibly damaging	0.79
R7028:Pla2r1	UTSW	2	60458393	missense	probably damaging	0.98
R7291:Pla2r1	UTSW	2	60530435	missense	probably benign	0.43
R7350:Pla2r1	UTSW	2	60458379	missense	probably benign	0.02
R7451:Pla2r1	UTSW	2	60535002	missense	probably damaging	1.00
R7553:Pla2r1	UTSW	2	60522899	missense	possibly damaging	0.80
R7635:Pla2r1	UTSW	2	60534762	missense	probably benign	0.09
R7768:Pla2r1	UTSW	2	60448946	missense	probably benign	0.22
R7774:Pla2r1	UTSW	2	60530458	nonsense	probably null
R7782:Pla2r1	UTSW	2	60504187	missense	probably benign	0.01
R7832:Pla2r1	UTSW	2	60504192	missense	possibly damaging	0.79
R7843:Pla2r1	UTSW	2	60447475	missense	possibly damaging	0.88
R7900:Pla2r1	UTSW	2	60428514	missense	possibly damaging	0.94
R8010:Pla2r1	UTSW	2	60514960	missense	probably benign	0.00
R8129:Pla2r1	UTSW	2	60432600	missense	probably damaging	1.00
R8336:Pla2r1	UTSW	2	60422683	missense	possibly damaging	0.88
R8347:Pla2r1	UTSW	2	60534903	missense	probably damaging	0.98
R8359:Pla2r1	UTSW	2	60443283	missense	probably benign	0.00
R8682:Pla2r1	UTSW	2	60422776	missense	possibly damaging	0.89
R8845:Pla2r1	UTSW	2	60428709	missense	possibly damaging	0.52
R8901:Pla2r1	UTSW	2	60502056	missense
R9085:Pla2r1	UTSW	2	60425447	missense	probably damaging	0.99
R9140:Pla2r1	UTSW	2	60441111	missense	probably benign	0.10
R9399:Pla2r1	UTSW	2	60452400	critical splice donor site	probably null
R9449:Pla2r1	UTSW	2	60428558	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGATAACCCCTCATCTTCTAGACAC -3'
(R):5'- GCAGCCTTGGCAATGAAGTG -3'

Sequencing Primer
(F):5'- TTCTAGACACACCTGGCATG -3'
(R):5'- ATCCCCTCTGCAGAATGGTCAG -3'

Posted On

2019-06-26