Incidental Mutation 'R0581:Stat6'
ID 56432
Institutional Source Beutler Lab
Gene Symbol Stat6
Ensembl Gene ENSMUSG00000002147
Gene Name signal transducer and activator of transcription 6
Synonyms
MMRRC Submission 038771-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.737) question?
Stock # R0581 (G1)
Quality Score 203
Status Validated
Chromosome 10
Chromosomal Location 127478855-127496826 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 127483985 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 89 (Q89L)
Ref Sequence ENSEMBL: ENSMUSP00000089708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092074] [ENSMUST00000120279]
AlphaFold P52633
Predicted Effect probably damaging
Transcript: ENSMUST00000092074
AA Change: Q89L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089708
Gene: ENSMUSG00000002147
AA Change: Q89L

DomainStartEndE-ValueType
STAT_int 2 116 2.76e-31 SMART
Pfam:STAT_bind 273 526 4.4e-87 PFAM
SH2 540 622 1.33e-5 SMART
Pfam:STAT6_C 655 837 1.1e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120279
SMART Domains Protein: ENSMUSP00000112722
Gene: ENSMUSG00000002147

DomainStartEndE-ValueType
Pfam:STAT_int 2 109 2.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128072
Meta Mutation Damage Score 0.5480 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.3%
  • 20x: 93.7%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein plays a central role in exerting IL4 mediated biological responses. It is found to induce the expression of BCL2L1/BCL-X(L), which is responsible for the anti-apoptotic activity of IL4. Knockout studies in mice suggested the roles of this gene in differentiation of T helper 2 (Th2) cells, expression of cell surface markers, and class switch of immunoglobulins. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired IL4 responses, including anti-IgM stimulated B cell proliferation, class switching to IgE, contact sensitivity, and Th2 cytokine production, and show increased resistance to certain infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 4,100,620 (GRCm39) T2761A probably benign Het
Apold1 G A 6: 134,960,776 (GRCm39) V77I probably benign Het
Atad2 T C 15: 57,990,060 (GRCm39) T139A probably benign Het
Cacna1a A T 8: 85,328,565 (GRCm39) I1668F possibly damaging Het
Ccer2 T A 7: 28,456,451 (GRCm39) probably benign Het
Cyp2c54 T A 19: 40,035,999 (GRCm39) T304S probably benign Het
Dpp4 T A 2: 62,187,020 (GRCm39) M497L probably benign Het
Evpl T A 11: 116,120,316 (GRCm39) I541L probably benign Het
Ggn A G 7: 28,871,729 (GRCm39) T370A probably benign Het
Ghr A G 15: 3,418,116 (GRCm39) probably benign Het
Gm6605 C A 7: 38,147,699 (GRCm39) noncoding transcript Het
Gpr68 G C 12: 100,844,815 (GRCm39) P243R probably damaging Het
Gtf3c2 G T 5: 31,316,862 (GRCm39) Y720* probably null Het
Il2rb T A 15: 78,366,136 (GRCm39) Y387F possibly damaging Het
Kcnu1 T A 8: 26,427,529 (GRCm39) V282E probably damaging Het
Krt222 G A 11: 99,127,018 (GRCm39) Q201* probably null Het
Lats1 A G 10: 7,578,705 (GRCm39) T610A possibly damaging Het
Mroh2a GT GTT 1: 88,183,888 (GRCm39) probably null Het
Myh7 T C 14: 55,222,953 (GRCm39) I751V probably benign Het
Mypn A G 10: 62,998,023 (GRCm39) I429T probably benign Het
Nemf A T 12: 69,369,045 (GRCm39) D723E probably benign Het
Nlrp4b T C 7: 10,448,457 (GRCm39) L220P probably damaging Het
Npr3 T A 15: 11,851,536 (GRCm39) D418V probably damaging Het
Nsd3 A G 8: 26,200,718 (GRCm39) N1270S probably damaging Het
Or1j15 T C 2: 36,458,834 (GRCm39) S75P probably damaging Het
Or2g1 A G 17: 38,106,993 (GRCm39) I219M probably damaging Het
Otogl G A 10: 107,624,901 (GRCm39) T1579I possibly damaging Het
Pkp2 T A 16: 16,087,647 (GRCm39) probably benign Het
Psd3 T C 8: 68,173,598 (GRCm39) Y301C probably damaging Het
Psmb4 T C 3: 94,793,479 (GRCm39) H134R probably damaging Het
Ralgapb A G 2: 158,334,881 (GRCm39) T1043A probably benign Het
Sec14l5 T A 16: 4,996,349 (GRCm39) probably null Het
Serpina12 T A 12: 103,997,399 (GRCm39) Q374L probably damaging Het
Serpinb10 C T 1: 107,474,692 (GRCm39) R362* probably null Het
Sorcs1 T A 19: 50,241,139 (GRCm39) I416F possibly damaging Het
Sparcl1 T C 5: 104,241,178 (GRCm39) D82G probably damaging Het
Tat A G 8: 110,718,270 (GRCm39) T52A possibly damaging Het
Yipf7 T A 5: 69,678,406 (GRCm39) I128F probably benign Het
Zfp112 T A 7: 23,825,288 (GRCm39) C419S probably damaging Het
Zzef1 A G 11: 72,742,726 (GRCm39) I769V probably benign Het
Other mutations in Stat6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Stat6 APN 10 127,490,801 (GRCm39) missense probably damaging 1.00
IGL01785:Stat6 APN 10 127,493,096 (GRCm39) missense probably damaging 1.00
IGL02939:Stat6 APN 10 127,482,809 (GRCm39) missense probably benign 0.05
IGL03266:Stat6 APN 10 127,493,024 (GRCm39) missense possibly damaging 0.88
IGL03412:Stat6 APN 10 127,494,074 (GRCm39) missense probably benign 0.00
Rigid UTSW 10 127,494,571 (GRCm39) critical splice donor site probably null
Stationary UTSW 10 127,488,091 (GRCm39) missense possibly damaging 0.93
PIT4142001:Stat6 UTSW 10 127,494,099 (GRCm39) missense possibly damaging 0.95
R0165:Stat6 UTSW 10 127,493,096 (GRCm39) missense probably damaging 0.98
R0735:Stat6 UTSW 10 127,494,110 (GRCm39) missense probably damaging 1.00
R1333:Stat6 UTSW 10 127,487,094 (GRCm39) missense possibly damaging 0.62
R1352:Stat6 UTSW 10 127,486,680 (GRCm39) missense probably benign 0.32
R1457:Stat6 UTSW 10 127,494,114 (GRCm39) missense probably damaging 0.98
R1538:Stat6 UTSW 10 127,489,125 (GRCm39) missense probably damaging 1.00
R1696:Stat6 UTSW 10 127,488,918 (GRCm39) missense probably damaging 1.00
R2016:Stat6 UTSW 10 127,486,665 (GRCm39) missense probably damaging 1.00
R3236:Stat6 UTSW 10 127,488,091 (GRCm39) missense possibly damaging 0.93
R3980:Stat6 UTSW 10 127,491,248 (GRCm39) missense probably damaging 1.00
R4467:Stat6 UTSW 10 127,487,097 (GRCm39) missense probably damaging 1.00
R5346:Stat6 UTSW 10 127,488,182 (GRCm39) missense probably benign 0.44
R5481:Stat6 UTSW 10 127,483,695 (GRCm39) splice site probably null
R5722:Stat6 UTSW 10 127,494,242 (GRCm39) missense probably benign 0.00
R6036:Stat6 UTSW 10 127,491,313 (GRCm39) missense possibly damaging 0.58
R6036:Stat6 UTSW 10 127,491,313 (GRCm39) missense possibly damaging 0.58
R6244:Stat6 UTSW 10 127,493,581 (GRCm39) splice site probably null
R6914:Stat6 UTSW 10 127,487,131 (GRCm39) missense probably damaging 1.00
R6937:Stat6 UTSW 10 127,494,571 (GRCm39) critical splice donor site probably null
R6942:Stat6 UTSW 10 127,487,131 (GRCm39) missense probably damaging 1.00
R8231:Stat6 UTSW 10 127,482,842 (GRCm39) missense possibly damaging 0.61
R8995:Stat6 UTSW 10 127,494,511 (GRCm39) missense probably benign 0.00
R9162:Stat6 UTSW 10 127,487,089 (GRCm39) missense probably damaging 0.99
R9192:Stat6 UTSW 10 127,493,479 (GRCm39) missense probably damaging 1.00
R9252:Stat6 UTSW 10 127,483,661 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGAAAGCACTTGCTATTCCTGTGGTT -3'
(R):5'- ACCTGTTCCTTCACTGAGGTGGAAA -3'

Sequencing Primer
(F):5'- ACTTGCTATTCCTGTGGTTAGGTG -3'
(R):5'- cttgccctctctgcctg -3'
Posted On 2013-07-11