Incidental Mutation 'R7257:Padi1'
ID 564324
Institutional Source Beutler Lab
Gene Symbol Padi1
Ensembl Gene ENSMUSG00000025329
Gene Name peptidyl arginine deiminase, type I
Synonyms Pad type 1, Pdi1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock # R7257 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 140812983-140845778 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 140829471 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 142 (G142C)
Ref Sequence ENSEMBL: ENSMUSP00000026378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026378]
AlphaFold Q9Z185
Predicted Effect probably damaging
Transcript: ENSMUST00000026378
AA Change: G142C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026378
Gene: ENSMUSG00000025329
AA Change: G142C

DomainStartEndE-ValueType
Pfam:PAD_N 1 113 5.4e-39 PFAM
Pfam:PAD_M 115 272 1.3e-63 PFAM
Pfam:PAD 280 659 9.4e-170 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type I enzyme is involved in the late stages of epidermal differentiation, where it deiminates filaggrin and keratin K1, which maintains hydration of the stratum corneum, and hence the cutaneous barrier function. This enzyme may also play a role in hair follicle formation. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A T 6: 88,839,452 V120E probably benign Het
Acot11 G A 4: 106,758,402 T284M probably damaging Het
Adk G T 14: 21,052,671 K11N probably damaging Het
Akr1c14 T A 13: 4,088,966 N316K probably benign Het
AL732309.1 A T 2: 25,245,839 V121D probably benign Het
Amh C A 10: 80,806,653 Q257K probably benign Het
Antxrl T G 14: 34,065,849 H276Q probably benign Het
Atp5o G A 16: 91,926,867 T105M probably damaging Het
Atp5s T C 12: 69,741,669 I114T probably damaging Het
Atxn2 T G 5: 121,785,817 N734K possibly damaging Het
B3gat3 T A 19: 8,925,738 V153D probably benign Het
Brd2 A G 17: 34,113,822 V528A probably damaging Het
Camk2g T C 14: 20,747,839 S335G probably benign Het
Cbln2 T A 18: 86,716,734 W211R probably damaging Het
Cry2 A T 2: 92,412,981 I505N possibly damaging Het
Ddx55 T A 5: 124,560,721 C249S possibly damaging Het
Dglucy A G 12: 100,842,738 T232A probably damaging Het
Dhx32 A G 7: 133,759,477 Y76H probably benign Het
Dock7 T A 4: 98,973,412 N1356I unknown Het
Dock8 T A 19: 25,127,085 N710K probably benign Het
Dync1i2 T A 2: 71,249,356 N391K possibly damaging Het
Ect2 A G 3: 27,138,535 S420P probably damaging Het
Efcab5 T A 11: 77,137,779 E242V probably damaging Het
Fam83g T A 11: 61,684,753 Y74N probably damaging Het
Fbxo34 T A 14: 47,500,872 probably null Het
Flt4 A G 11: 49,626,009 T208A probably benign Het
Fxyd5 T A 7: 31,035,151 H183L unknown Het
Gpr150 T G 13: 76,056,466 D120A probably benign Het
Grm7 A G 6: 110,646,118 Y84C probably damaging Het
Ighmbp2 A G 19: 3,266,405 S562P probably damaging Het
Itga7 A G 10: 128,944,413 Y530C possibly damaging Het
Itpr3 T A 17: 27,118,561 D2448E probably benign Het
Mmp17 C A 5: 129,595,633 H216Q probably benign Het
Mns1 C T 9: 72,452,815 R416W probably damaging Het
Mog A G 17: 37,023,127 S25P unknown Het
Myh2 A G 11: 67,181,150 K568R possibly damaging Het
Myh7 A T 14: 54,972,490 probably null Het
Mymk A T 2: 27,067,368 W79R probably damaging Het
Ncoa4 T G 14: 32,177,369 L623R probably damaging Het
Oca2 G A 7: 56,279,538 probably benign Het
Odam A C 5: 87,887,545 S123R probably benign Het
Olfr1155 A G 2: 87,943,571 F19S probably damaging Het
Olfr263 A G 13: 21,133,257 T161A probably benign Het
Olfr292 T A 7: 86,694,804 M116K probably damaging Het
Olfr583 T C 7: 103,051,630 F111L probably benign Het
Olfr765 C T 10: 129,046,455 V203M probably benign Het
Olfr816 T A 10: 129,912,287 probably benign Het
Ovch2 C T 7: 107,794,433 C162Y probably damaging Het
Pcdhga4 A G 18: 37,687,398 I667V probably damaging Het
Pfas A T 11: 68,992,959 V624E probably damaging Het
Phb A T 11: 95,678,091 E184V probably damaging Het
Phlpp2 G T 8: 109,940,188 M1116I probably benign Het
Pip5kl1 T C 2: 32,580,431 probably null Het
Pitpnm2 T A 5: 124,125,356 I824F possibly damaging Het
Pla2g4c G A 7: 13,325,744 S2N possibly damaging Het
Pla2r1 A T 2: 60,427,625 probably null Het
Pole2 T C 12: 69,202,910 D521G probably damaging Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rapgef2 A T 3: 79,082,627 L931Q probably damaging Het
Rassf3 G A 10: 121,413,019 Q206* probably null Het
Rnf123 T A 9: 108,069,029 T316S probably damaging Het
Rnf138 T A 18: 21,008,693 probably null Het
Sept3 G A 15: 82,289,213 A249T probably damaging Het
Slc35a4 A T 18: 36,679,616 D3V unknown Het
Sltm T A 9: 70,543,965 probably null Het
Smarca2 C T 19: 26,654,464 Q560* probably null Het
Tcl1b1 A T 12: 105,164,531 D91V probably damaging Het
Tirap A T 9: 35,189,034 V118E probably damaging Het
Tlr5 T A 1: 182,974,233 Y367* probably null Het
Tmcc1 A G 6: 116,107,338 F5L probably benign Het
Tnxb A G 17: 34,716,501 M2592V probably benign Het
Trim66 T A 7: 109,460,244 E931V probably damaging Het
Ttn A G 2: 76,741,094 I26485T probably damaging Het
Veph1 C A 3: 66,158,282 V455L probably benign Het
Vmn1r125 A T 7: 21,272,825 H216L probably damaging Het
Wdr17 T A 8: 54,632,487 E1200D probably benign Het
Zbtb37 T A 1: 161,032,661 N25Y probably damaging Het
Other mutations in Padi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01844:Padi1 APN 4 140829435 missense probably damaging 1.00
IGL01972:Padi1 APN 4 140818859 splice site probably benign
IGL03260:Padi1 APN 4 140828194 missense probably benign 0.11
R0598:Padi1 UTSW 4 140814787 missense possibly damaging 0.84
R1164:Padi1 UTSW 4 140832329 missense possibly damaging 0.50
R1793:Padi1 UTSW 4 140814656 missense probably damaging 1.00
R4208:Padi1 UTSW 4 140817227 missense possibly damaging 0.80
R4256:Padi1 UTSW 4 140814778 missense probably damaging 1.00
R4484:Padi1 UTSW 4 140817270 intron probably benign
R4926:Padi1 UTSW 4 140824847 missense probably damaging 0.99
R4967:Padi1 UTSW 4 140845590 missense probably benign 0.00
R5066:Padi1 UTSW 4 140829437 missense probably damaging 1.00
R5523:Padi1 UTSW 4 140814853 missense probably damaging 1.00
R5622:Padi1 UTSW 4 140824955 missense probably damaging 1.00
R5850:Padi1 UTSW 4 140814830 missense probably benign 0.03
R5870:Padi1 UTSW 4 140826581 missense probably benign 0.39
R5951:Padi1 UTSW 4 140814829 missense probably damaging 1.00
R6187:Padi1 UTSW 4 140826965 missense probably damaging 1.00
R7326:Padi1 UTSW 4 140832404 missense probably benign 0.15
R7339:Padi1 UTSW 4 140829234 missense probably null 0.98
R8282:Padi1 UTSW 4 140814703 missense probably damaging 1.00
R9083:Padi1 UTSW 4 140832291 critical splice donor site probably null
R9590:Padi1 UTSW 4 140817241 missense not run
X0024:Padi1 UTSW 4 140828167 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGTGGCTTTTGAGACAAGC -3'
(R):5'- ACTACACAAGGATGGCCATCTC -3'

Sequencing Primer
(F):5'- GCTTTTGAGACAAGCCCCCAAC -3'
(R):5'- ATGGCCATCTCTGGGTCTAAGC -3'
Posted On 2019-06-26