Incidental Mutation 'R7257:Grm7'
ID564331
Institutional Source Beutler Lab
Gene Symbol Grm7
Ensembl Gene ENSMUSG00000056755
Gene Nameglutamate receptor, metabotropic 7
SynonymsGpr1g, mGlu7a receptor, mGluR7, E130018M02Rik, 6330570A01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7257 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location110645581-111567230 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110646118 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 84 (Y84C)
Ref Sequence ENSEMBL: ENSMUSP00000133957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071076] [ENSMUST00000172951] [ENSMUST00000174018]
Predicted Effect probably damaging
Transcript: ENSMUST00000071076
AA Change: Y84C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064404
Gene: ENSMUSG00000056755
AA Change: Y84C

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 484 3e-108 PFAM
Pfam:Peripla_BP_6 144 371 3e-11 PFAM
Pfam:NCD3G 519 569 1.2e-13 PFAM
Pfam:7tm_3 602 847 5.1e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172951
AA Change: Y84C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133957
Gene: ENSMUSG00000056755
AA Change: Y84C

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 484 1.7e-103 PFAM
Pfam:Peripla_BP_6 144 487 1e-12 PFAM
Pfam:NCD3G 519 569 1.2e-17 PFAM
Pfam:7tm_3 600 848 1.4e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174018
AA Change: Y84C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134635
Gene: ENSMUSG00000056755
AA Change: Y84C

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 176 4.9e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Nullizygous mice exhibit epilepsy and deficits in fear response and conditioned taste aversion. Homozygotes for a knock-in allele show impaired spatial working memory and higher susceptibility to PTZ. Homozygotes for a reporter allele show impaired coordination and higher susceptibility to metrazol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A T 6: 88,839,452 V120E probably benign Het
Acot11 G A 4: 106,758,402 T284M probably damaging Het
Adk G T 14: 21,052,671 K11N probably damaging Het
Akr1c14 T A 13: 4,088,966 N316K probably benign Het
AL732309.1 A T 2: 25,245,839 V121D probably benign Het
Amh C A 10: 80,806,653 Q257K probably benign Het
Antxrl T G 14: 34,065,849 H276Q probably benign Het
Atp5o G A 16: 91,926,867 T105M probably damaging Het
Atp5s T C 12: 69,741,669 I114T probably damaging Het
Atxn2 T G 5: 121,785,817 N734K possibly damaging Het
B3gat3 T A 19: 8,925,738 V153D probably benign Het
Brd2 A G 17: 34,113,822 V528A probably damaging Het
Camk2g T C 14: 20,747,839 S335G probably benign Het
Cbln2 T A 18: 86,716,734 W211R probably damaging Het
Cry2 A T 2: 92,412,981 I505N possibly damaging Het
Ddx55 T A 5: 124,560,721 C249S possibly damaging Het
Dglucy A G 12: 100,842,738 T232A probably damaging Het
Dhx32 A G 7: 133,759,477 Y76H probably benign Het
Dock7 T A 4: 98,973,412 N1356I unknown Het
Dock8 T A 19: 25,127,085 N710K probably benign Het
Dync1i2 T A 2: 71,249,356 N391K possibly damaging Het
Ect2 A G 3: 27,138,535 S420P probably damaging Het
Efcab5 T A 11: 77,137,779 E242V probably damaging Het
Fam83g T A 11: 61,684,753 Y74N probably damaging Het
Fbxo34 T A 14: 47,500,872 probably null Het
Flt4 A G 11: 49,626,009 T208A probably benign Het
Fxyd5 T A 7: 31,035,151 H183L unknown Het
Gpr150 T G 13: 76,056,466 D120A probably benign Het
Ighmbp2 A G 19: 3,266,405 S562P probably damaging Het
Itga7 A G 10: 128,944,413 Y530C possibly damaging Het
Itpr3 T A 17: 27,118,561 D2448E probably benign Het
Mmp17 C A 5: 129,595,633 H216Q probably benign Het
Mns1 C T 9: 72,452,815 R416W probably damaging Het
Mog A G 17: 37,023,127 S25P unknown Het
Myh2 A G 11: 67,181,150 K568R possibly damaging Het
Myh7 A T 14: 54,972,490 probably null Het
Mymk A T 2: 27,067,368 W79R probably damaging Het
Ncoa4 T G 14: 32,177,369 L623R probably damaging Het
Oca2 G A 7: 56,279,538 probably benign Het
Odam A C 5: 87,887,545 S123R probably benign Het
Olfr1155 A G 2: 87,943,571 F19S probably damaging Het
Olfr263 A G 13: 21,133,257 T161A probably benign Het
Olfr292 T A 7: 86,694,804 M116K probably damaging Het
Olfr583 T C 7: 103,051,630 F111L probably benign Het
Olfr765 C T 10: 129,046,455 V203M probably benign Het
Olfr816 T A 10: 129,912,287 probably benign Het
Ovch2 C T 7: 107,794,433 C162Y probably damaging Het
Padi1 C A 4: 140,829,471 G142C probably damaging Het
Pcdhga4 A G 18: 37,687,398 I667V probably damaging Het
Pfas A T 11: 68,992,959 V624E probably damaging Het
Phb A T 11: 95,678,091 E184V probably damaging Het
Phlpp2 G T 8: 109,940,188 M1116I probably benign Het
Pip5kl1 T C 2: 32,580,431 probably null Het
Pitpnm2 T A 5: 124,125,356 I824F possibly damaging Het
Pla2g4c G A 7: 13,325,744 S2N possibly damaging Het
Pla2r1 A T 2: 60,427,625 probably null Het
Pole2 T C 12: 69,202,910 D521G probably damaging Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rapgef2 A T 3: 79,082,627 L931Q probably damaging Het
Rassf3 G A 10: 121,413,019 Q206* probably null Het
Rnf123 T A 9: 108,069,029 T316S probably damaging Het
Rnf138 T A 18: 21,008,693 probably null Het
Sept3 G A 15: 82,289,213 A249T probably damaging Het
Slc35a4 A T 18: 36,679,616 D3V unknown Het
Sltm T A 9: 70,543,965 probably null Het
Smarca2 C T 19: 26,654,464 Q560* probably null Het
Tcl1b1 A T 12: 105,164,531 D91V probably damaging Het
Tirap A T 9: 35,189,034 V118E probably damaging Het
Tlr5 T A 1: 182,974,233 Y367* probably null Het
Tmcc1 A G 6: 116,107,338 F5L probably benign Het
Tnxb A G 17: 34,716,501 M2592V probably benign Het
Trim66 T A 7: 109,460,244 E931V probably damaging Het
Ttn A G 2: 76,741,094 I26485T probably damaging Het
Veph1 C A 3: 66,158,282 V455L probably benign Het
Vmn1r125 A T 7: 21,272,825 H216L probably damaging Het
Wdr17 T A 8: 54,632,487 E1200D probably benign Het
Zbtb37 T A 1: 161,032,661 N25Y probably damaging Het
Other mutations in Grm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Grm7 APN 6 111246184 missense probably benign 0.14
IGL02058:Grm7 APN 6 111358317 missense probably damaging 1.00
IGL02650:Grm7 APN 6 111358958 missense probably damaging 1.00
IGL02892:Grm7 APN 6 111254020 missense probably damaging 0.99
IGL03074:Grm7 APN 6 111495643 splice site probably null
IGL03185:Grm7 APN 6 110646222 missense possibly damaging 0.84
Appropriated UTSW 6 111495681 missense possibly damaging 0.64
Consumed UTSW 6 111358875 missense probably damaging 1.00
Devoured UTSW 6 111358824 missense probably damaging 1.00
shaky UTSW 6 111495791 nonsense probably null
PIT4651001:Grm7 UTSW 6 110646089 missense probably benign
R0539:Grm7 UTSW 6 111359094 splice site probably benign
R0622:Grm7 UTSW 6 111358496 missense probably damaging 1.00
R1356:Grm7 UTSW 6 111359024 missense probably damaging 1.00
R1762:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1783:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1785:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1816:Grm7 UTSW 6 111495791 nonsense probably null
R1823:Grm7 UTSW 6 111207769 missense probably benign 0.17
R1864:Grm7 UTSW 6 111080423 missense probably benign 0.03
R1894:Grm7 UTSW 6 111358607 missense probably benign
R1987:Grm7 UTSW 6 110914511 missense probably damaging 1.00
R1993:Grm7 UTSW 6 111207808 missense probably benign 0.13
R2138:Grm7 UTSW 6 110646137 missense probably damaging 1.00
R2214:Grm7 UTSW 6 111358997 missense probably damaging 1.00
R2289:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2296:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2339:Grm7 UTSW 6 111495681 missense possibly damaging 0.64
R2847:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2849:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2879:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2884:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2921:Grm7 UTSW 6 111495905 splice site probably null
R2923:Grm7 UTSW 6 111495905 splice site probably null
R3014:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3015:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3703:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3713:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3963:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4009:Grm7 UTSW 6 111495722 missense probably damaging 1.00
R4091:Grm7 UTSW 6 110914340 missense probably damaging 1.00
R4131:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4132:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4161:Grm7 UTSW 6 111254020 missense probably damaging 0.99
R4329:Grm7 UTSW 6 110914364 missense probably damaging 1.00
R4357:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4359:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4379:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4379:Grm7 UTSW 6 111246374 missense probably benign 0.05
R4380:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4514:Grm7 UTSW 6 111358304 missense possibly damaging 0.81
R4518:Grm7 UTSW 6 110914546 splice site probably null
R4647:Grm7 UTSW 6 110914383 nonsense probably null
R4714:Grm7 UTSW 6 111080422 missense possibly damaging 0.52
R4775:Grm7 UTSW 6 110914371 missense probably damaging 1.00
R4957:Grm7 UTSW 6 111358863 missense probably damaging 1.00
R5056:Grm7 UTSW 6 111080443 missense probably damaging 0.99
R5062:Grm7 UTSW 6 110646136 missense probably damaging 1.00
R5256:Grm7 UTSW 6 111358221 missense probably benign 0.01
R5431:Grm7 UTSW 6 111358426 missense probably benign
R6026:Grm7 UTSW 6 111501539 nonsense probably null
R6174:Grm7 UTSW 6 111246297 missense probably benign
R6305:Grm7 UTSW 6 111358665 missense probably damaging 1.00
R6318:Grm7 UTSW 6 111358875 missense probably damaging 1.00
R6440:Grm7 UTSW 6 111254020 missense probably damaging 1.00
R6519:Grm7 UTSW 6 111207752 missense probably benign 0.00
R6531:Grm7 UTSW 6 111358425 missense probably benign 0.29
R6888:Grm7 UTSW 6 111358353 missense possibly damaging 0.79
R6949:Grm7 UTSW 6 110646304 missense probably benign 0.03
R6949:Grm7 UTSW 6 111495729 missense probably damaging 1.00
R6989:Grm7 UTSW 6 111207805 missense probably damaging 1.00
R7076:Grm7 UTSW 6 111358152 missense probably benign 0.04
R7203:Grm7 UTSW 6 111358569 missense possibly damaging 0.94
R7208:Grm7 UTSW 6 111358569 missense possibly damaging 0.94
R7217:Grm7 UTSW 6 111358824 missense probably damaging 1.00
R7297:Grm7 UTSW 6 110646013 missense probably benign 0.16
R7470:Grm7 UTSW 6 111501515 missense
R7567:Grm7 UTSW 6 111358761 missense probably damaging 0.96
R7806:Grm7 UTSW 6 111246353 nonsense probably null
R8018:Grm7 UTSW 6 111207776 missense probably benign 0.01
R8076:Grm7 UTSW 6 111566039 missense probably damaging 1.00
Z1176:Grm7 UTSW 6 111358149 missense probably benign 0.01
Z1176:Grm7 UTSW 6 111358490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGAAGTTCCCCTGCTGC -3'
(R):5'- TCTCTGGCTTGACGAAAACC -3'

Sequencing Primer
(F):5'- AGGTGCTCCTGTGCGTGC -3'
(R):5'- CTTGACGAAAACCGGGGGC -3'
Posted On2019-06-26