Incidental Mutation 'R7257:Fxyd5'
ID 564335
Institutional Source Beutler Lab
Gene Symbol Fxyd5
Ensembl Gene ENSMUSG00000009687
Gene Name FXYD domain-containing ion transport regulator 5
Synonyms EF-8, Oit2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R7257 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 31032722-31042481 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 31035151 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 183 (H183L)
Ref Sequence ENSEMBL: ENSMUSP00000125173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009831] [ENSMUST00000159753] [ENSMUST00000159924] [ENSMUST00000160689] [ENSMUST00000161684] [ENSMUST00000161805] [ENSMUST00000162087] [ENSMUST00000162116] [ENSMUST00000162733] [ENSMUST00000202395]
AlphaFold P97808
Predicted Effect probably benign
Transcript: ENSMUST00000009831
SMART Domains Protein: ENSMUSP00000009831
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 130 176 8.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159753
SMART Domains Protein: ENSMUSP00000123813
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159924
SMART Domains Protein: ENSMUSP00000124219
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160689
SMART Domains Protein: ENSMUSP00000125187
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161684
SMART Domains Protein: ENSMUSP00000125285
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161805
SMART Domains Protein: ENSMUSP00000125398
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162087
SMART Domains Protein: ENSMUSP00000125065
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 130 174 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162116
SMART Domains Protein: ENSMUSP00000124203
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162250
SMART Domains Protein: ENSMUSP00000124129
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 69 113 7.5e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000162733
AA Change: H183L
SMART Domains Protein: ENSMUSP00000125173
Gene: ENSMUSG00000009687
AA Change: H183L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 131 167 6.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202395
SMART Domains Protein: ENSMUSP00000144377
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 52 67 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: This gene encodes a precursor protein that is member of the FXYD family of transmembrane glycoproteins. Like most members of the FXYD family, the encoded protein is a subunit of the sodium-potassium adenosine triphosphatase pump. FXYD family members have tissue-specific expression and differentially regulate the activity of this pump. The protein encoded by this gene also plays a role in cell adhesion and motility. The orthologous human protein inhibits epithelial cadherin, a calcium-dependent adhesion protein and is associated with cancer (promotes metastasis). Alternative splicing of this mouse gene results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A T 6: 88,839,452 V120E probably benign Het
Acot11 G A 4: 106,758,402 T284M probably damaging Het
Adk G T 14: 21,052,671 K11N probably damaging Het
Akr1c14 T A 13: 4,088,966 N316K probably benign Het
AL732309.1 A T 2: 25,245,839 V121D probably benign Het
Amh C A 10: 80,806,653 Q257K probably benign Het
Antxrl T G 14: 34,065,849 H276Q probably benign Het
Atp5o G A 16: 91,926,867 T105M probably damaging Het
Atp5s T C 12: 69,741,669 I114T probably damaging Het
Atxn2 T G 5: 121,785,817 N734K possibly damaging Het
B3gat3 T A 19: 8,925,738 V153D probably benign Het
Brd2 A G 17: 34,113,822 V528A probably damaging Het
Camk2g T C 14: 20,747,839 S335G probably benign Het
Cbln2 T A 18: 86,716,734 W211R probably damaging Het
Cry2 A T 2: 92,412,981 I505N possibly damaging Het
Ddx55 T A 5: 124,560,721 C249S possibly damaging Het
Dglucy A G 12: 100,842,738 T232A probably damaging Het
Dhx32 A G 7: 133,759,477 Y76H probably benign Het
Dock7 T A 4: 98,973,412 N1356I unknown Het
Dock8 T A 19: 25,127,085 N710K probably benign Het
Dync1i2 T A 2: 71,249,356 N391K possibly damaging Het
Ect2 A G 3: 27,138,535 S420P probably damaging Het
Efcab5 T A 11: 77,137,779 E242V probably damaging Het
Fam83g T A 11: 61,684,753 Y74N probably damaging Het
Fbxo34 T A 14: 47,500,872 probably null Het
Flt4 A G 11: 49,626,009 T208A probably benign Het
Gpr150 T G 13: 76,056,466 D120A probably benign Het
Grm7 A G 6: 110,646,118 Y84C probably damaging Het
Ighmbp2 A G 19: 3,266,405 S562P probably damaging Het
Itga7 A G 10: 128,944,413 Y530C possibly damaging Het
Itpr3 T A 17: 27,118,561 D2448E probably benign Het
Mmp17 C A 5: 129,595,633 H216Q probably benign Het
Mns1 C T 9: 72,452,815 R416W probably damaging Het
Mog A G 17: 37,023,127 S25P unknown Het
Myh2 A G 11: 67,181,150 K568R possibly damaging Het
Myh7 A T 14: 54,972,490 probably null Het
Mymk A T 2: 27,067,368 W79R probably damaging Het
Ncoa4 T G 14: 32,177,369 L623R probably damaging Het
Oca2 G A 7: 56,279,538 probably benign Het
Odam A C 5: 87,887,545 S123R probably benign Het
Olfr1155 A G 2: 87,943,571 F19S probably damaging Het
Olfr263 A G 13: 21,133,257 T161A probably benign Het
Olfr292 T A 7: 86,694,804 M116K probably damaging Het
Olfr583 T C 7: 103,051,630 F111L probably benign Het
Olfr765 C T 10: 129,046,455 V203M probably benign Het
Olfr816 T A 10: 129,912,287 probably benign Het
Ovch2 C T 7: 107,794,433 C162Y probably damaging Het
Padi1 C A 4: 140,829,471 G142C probably damaging Het
Pcdhga4 A G 18: 37,687,398 I667V probably damaging Het
Pfas A T 11: 68,992,959 V624E probably damaging Het
Phb A T 11: 95,678,091 E184V probably damaging Het
Phlpp2 G T 8: 109,940,188 M1116I probably benign Het
Pip5kl1 T C 2: 32,580,431 probably null Het
Pitpnm2 T A 5: 124,125,356 I824F possibly damaging Het
Pla2g4c G A 7: 13,325,744 S2N possibly damaging Het
Pla2r1 A T 2: 60,427,625 probably null Het
Pole2 T C 12: 69,202,910 D521G probably damaging Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rapgef2 A T 3: 79,082,627 L931Q probably damaging Het
Rassf3 G A 10: 121,413,019 Q206* probably null Het
Rnf123 T A 9: 108,069,029 T316S probably damaging Het
Rnf138 T A 18: 21,008,693 probably null Het
Sept3 G A 15: 82,289,213 A249T probably damaging Het
Slc35a4 A T 18: 36,679,616 D3V unknown Het
Sltm T A 9: 70,543,965 probably null Het
Smarca2 C T 19: 26,654,464 Q560* probably null Het
Tcl1b1 A T 12: 105,164,531 D91V probably damaging Het
Tirap A T 9: 35,189,034 V118E probably damaging Het
Tlr5 T A 1: 182,974,233 Y367* probably null Het
Tmcc1 A G 6: 116,107,338 F5L probably benign Het
Tnxb A G 17: 34,716,501 M2592V probably benign Het
Trim66 T A 7: 109,460,244 E931V probably damaging Het
Ttn A G 2: 76,741,094 I26485T probably damaging Het
Veph1 C A 3: 66,158,282 V455L probably benign Het
Vmn1r125 A T 7: 21,272,825 H216L probably damaging Het
Wdr17 T A 8: 54,632,487 E1200D probably benign Het
Zbtb37 T A 1: 161,032,661 N25Y probably damaging Het
Other mutations in Fxyd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01910:Fxyd5 APN 7 31035218 missense probably damaging 0.96
IGL01913:Fxyd5 APN 7 31035212 missense probably damaging 0.99
IGL02071:Fxyd5 APN 7 31040188 missense possibly damaging 0.46
IGL02800:Fxyd5 APN 7 31032979 missense possibly damaging 0.95
Uptown UTSW 7 31041429 missense probably damaging 1.00
R1812:Fxyd5 UTSW 7 31037930 critical splice acceptor site probably null
R2362:Fxyd5 UTSW 7 31036471 missense probably benign 0.00
R3690:Fxyd5 UTSW 7 31036439 missense possibly damaging 0.95
R4279:Fxyd5 UTSW 7 31035386 missense probably null 1.00
R4786:Fxyd5 UTSW 7 31041482 unclassified probably benign
R6410:Fxyd5 UTSW 7 31035406 missense probably damaging 1.00
R6465:Fxyd5 UTSW 7 31037880 missense probably damaging 0.96
R7309:Fxyd5 UTSW 7 31035404 missense probably benign 0.00
R8270:Fxyd5 UTSW 7 31041429 missense probably damaging 1.00
Z1186:Fxyd5 UTSW 7 31035163 missense unknown
Z1186:Fxyd5 UTSW 7 31037931 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AAGAGACGTGCACTCTAGGAAC -3'
(R):5'- ACTACGGTAAGTTACCCCGC -3'

Sequencing Primer
(F):5'- TGCACTCTAGGAACAGCGC -3'
(R):5'- CGCACCGCTGGAGATAAGTG -3'
Posted On 2019-06-26