Mutagenetix > Incidental Mutation

Incidental Mutation 'R7257:Rnf123'

564345

Institutional Source

Beutler Lab

Gene Symbol

Rnf123

Ensembl Gene

ENSMUSG00000041528

Gene Name

ring finger protein 123

Synonyms

KPC1

MMRRC Submission

045318-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.174) question?

Stock #

R7257 (G1)

Quality Score

219.009

Status

Validated

Chromosome

Chromosomal Location

108051534-108083346 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 108069029 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 316 (T316S)

Ref Sequence

ENSEMBL: ENSMUSP00000125745 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000174504] [ENSMUST00000178267]

AlphaFold

Q5XPI3

Predicted Effect

probably damaging
Transcript: ENSMUST00000047746
AA Change: T316S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: T316S

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160249
AA Change: T316S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: T316S

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160649
AA Change: T316S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: T316S

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161828

Predicted Effect

probably damaging
Transcript: ENSMUST00000162355
AA Change: T316S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: T316S

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162516

Predicted Effect

probably benign
Transcript: ENSMUST00000174504

Predicted Effect

probably damaging
Transcript: ENSMUST00000178267
AA Change: T316S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: T316S

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Meta Mutation Damage Score

0.1533

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb1	A	T	6: 88,839,452	V120E	probably benign	Het
Acot11	G	A	4: 106,758,402	T284M	probably damaging	Het
Adk	G	T	14: 21,052,671	K11N	probably damaging	Het
Akr1c14	T	A	13: 4,088,966	N316K	probably benign	Het
AL732309.1	A	T	2: 25,245,839	V121D	probably benign	Het
Amh	C	A	10: 80,806,653	Q257K	probably benign	Het
Antxrl	T	G	14: 34,065,849	H276Q	probably benign	Het
Atp5o	G	A	16: 91,926,867	T105M	probably damaging	Het
Atp5s	T	C	12: 69,741,669	I114T	probably damaging	Het
Atxn2	T	G	5: 121,785,817	N734K	possibly damaging	Het
B3gat3	T	A	19: 8,925,738	V153D	probably benign	Het
Brd2	A	G	17: 34,113,822	V528A	probably damaging	Het
Camk2g	T	C	14: 20,747,839	S335G	probably benign	Het
Cbln2	T	A	18: 86,716,734	W211R	probably damaging	Het
Cry2	A	T	2: 92,412,981	I505N	possibly damaging	Het
Ddx55	T	A	5: 124,560,721	C249S	possibly damaging	Het
Dglucy	A	G	12: 100,842,738	T232A	probably damaging	Het
Dhx32	A	G	7: 133,759,477	Y76H	probably benign	Het
Dock7	T	A	4: 98,973,412	N1356I	unknown	Het
Dock8	T	A	19: 25,127,085	N710K	probably benign	Het
Dync1i2	T	A	2: 71,249,356	N391K	possibly damaging	Het
Ect2	A	G	3: 27,138,535	S420P	probably damaging	Het
Efcab5	T	A	11: 77,137,779	E242V	probably damaging	Het
Fam83g	T	A	11: 61,684,753	Y74N	probably damaging	Het
Fbxo34	T	A	14: 47,500,872		probably null	Het
Flt4	A	G	11: 49,626,009	T208A	probably benign	Het
Fxyd5	T	A	7: 31,035,151	H183L	unknown	Het
Gpr150	T	G	13: 76,056,466	D120A	probably benign	Het
Grm7	A	G	6: 110,646,118	Y84C	probably damaging	Het
Ighmbp2	A	G	19: 3,266,405	S562P	probably damaging	Het
Itga7	A	G	10: 128,944,413	Y530C	possibly damaging	Het
Itpr3	T	A	17: 27,118,561	D2448E	probably benign	Het
Mmp17	C	A	5: 129,595,633	H216Q	probably benign	Het
Mns1	C	T	9: 72,452,815	R416W	probably damaging	Het
Mog	A	G	17: 37,023,127	S25P	unknown	Het
Myh2	A	G	11: 67,181,150	K568R	possibly damaging	Het
Myh7	A	T	14: 54,972,490		probably null	Het
Mymk	A	T	2: 27,067,368	W79R	probably damaging	Het
Ncoa4	T	G	14: 32,177,369	L623R	probably damaging	Het
Oca2	G	A	7: 56,279,538		probably benign	Het
Odam	A	C	5: 87,887,545	S123R	probably benign	Het
Olfr1155	A	G	2: 87,943,571	F19S	probably damaging	Het
Olfr263	A	G	13: 21,133,257	T161A	probably benign	Het
Olfr292	T	A	7: 86,694,804	M116K	probably damaging	Het
Olfr583	T	C	7: 103,051,630	F111L	probably benign	Het
Olfr765	C	T	10: 129,046,455	V203M	probably benign	Het
Olfr816	T	A	10: 129,912,287		probably benign	Het
Ovch2	C	T	7: 107,794,433	C162Y	probably damaging	Het
Padi1	C	A	4: 140,829,471	G142C	probably damaging	Het
Pcdhga4	A	G	18: 37,687,398	I667V	probably damaging	Het
Pfas	A	T	11: 68,992,959	V624E	probably damaging	Het
Phb	A	T	11: 95,678,091	E184V	probably damaging	Het
Phlpp2	G	T	8: 109,940,188	M1116I	probably benign	Het
Pip5kl1	T	C	2: 32,580,431		probably null	Het
Pitpnm2	T	A	5: 124,125,356	I824F	possibly damaging	Het
Pla2g4c	G	A	7: 13,325,744	S2N	possibly damaging	Het
Pla2r1	A	T	2: 60,427,625		probably null	Het
Pole2	T	C	12: 69,202,910	D521G	probably damaging	Het
Ptch1	T	C	13: 63,573,294	K54E	not run	Het
Rapgef2	A	T	3: 79,082,627	L931Q	probably damaging	Het
Rassf3	G	A	10: 121,413,019	Q206*	probably null	Het
Rnf138	T	A	18: 21,008,693		probably null	Het
Sept3	G	A	15: 82,289,213	A249T	probably damaging	Het
Slc35a4	A	T	18: 36,679,616	D3V	unknown	Het
Sltm	T	A	9: 70,543,965		probably null	Het
Smarca2	C	T	19: 26,654,464	Q560*	probably null	Het
Tcl1b1	A	T	12: 105,164,531	D91V	probably damaging	Het
Tirap	A	T	9: 35,189,034	V118E	probably damaging	Het
Tlr5	T	A	1: 182,974,233	Y367*	probably null	Het
Tmcc1	A	G	6: 116,107,338	F5L	probably benign	Het
Tnxb	A	G	17: 34,716,501	M2592V	probably benign	Het
Trim66	T	A	7: 109,460,244	E931V	probably damaging	Het
Ttn	A	G	2: 76,741,094	I26485T	probably damaging	Het
Veph1	C	A	3: 66,158,282	V455L	probably benign	Het
Vmn1r125	A	T	7: 21,272,825	H216L	probably damaging	Het
Wdr17	T	A	8: 54,632,487	E1200D	probably benign	Het
Zbtb37	T	A	1: 161,032,661	N25Y	probably damaging	Het

Other mutations in Rnf123

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Rnf123	APN	9	108067395	critical splice donor site	probably null
IGL01358:Rnf123	APN	9	108069182	missense	probably damaging	1.00
IGL01464:Rnf123	APN	9	108052302	missense	probably damaging	1.00
IGL01637:Rnf123	APN	9	108058238	missense	probably damaging	1.00
IGL01669:Rnf123	APN	9	108058356	missense	probably damaging	0.98
IGL01905:Rnf123	APN	9	108071370	splice site	probably benign
IGL02070:Rnf123	APN	9	108068302	nonsense	probably null
IGL02072:Rnf123	APN	9	108068302	nonsense	probably null
IGL02073:Rnf123	APN	9	108068302	nonsense	probably null
IGL02074:Rnf123	APN	9	108066889	missense	probably damaging	1.00
IGL02079:Rnf123	APN	9	108068302	nonsense	probably null
IGL02080:Rnf123	APN	9	108068302	nonsense	probably null
IGL02231:Rnf123	APN	9	108066399	missense	probably benign	0.17
IGL02281:Rnf123	APN	9	108071452	missense	probably benign	0.01
IGL02336:Rnf123	APN	9	108061842	missense	probably damaging	1.00
IGL02543:Rnf123	APN	9	108066348	missense	probably damaging	1.00
IGL02565:Rnf123	APN	9	108052212	critical splice donor site	probably null
IGL02571:Rnf123	APN	9	108068302	nonsense	probably null
IGL02572:Rnf123	APN	9	108068302	nonsense	probably null
IGL02574:Rnf123	APN	9	108068302	nonsense	probably null
IGL02586:Rnf123	APN	9	108068302	nonsense	probably null
IGL02589:Rnf123	APN	9	108068302	nonsense	probably null
IGL02600:Rnf123	APN	9	108068302	nonsense	probably null
IGL02601:Rnf123	APN	9	108068302	nonsense	probably null
IGL02602:Rnf123	APN	9	108068302	nonsense	probably null
IGL02603:Rnf123	APN	9	108068302	nonsense	probably null
IGL02609:Rnf123	APN	9	108068302	nonsense	probably null
IGL02628:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108070789	splice site	probably benign
IGL02630:Rnf123	APN	9	108068302	nonsense	probably null
IGL02631:Rnf123	APN	9	108068302	nonsense	probably null
IGL02632:Rnf123	APN	9	108068302	nonsense	probably null
IGL02650:Rnf123	APN	9	108069748	missense	probably benign	0.29
IGL02690:Rnf123	APN	9	108068302	nonsense	probably null
IGL02691:Rnf123	APN	9	108068302	nonsense	probably null
IGL02692:Rnf123	APN	9	108068302	nonsense	probably null
IGL02693:Rnf123	APN	9	108068302	nonsense	probably null
IGL02713:Rnf123	APN	9	108068302	nonsense	probably null
IGL02736:Rnf123	APN	9	108068302	nonsense	probably null
IGL02929:Rnf123	APN	9	108069076	missense	probably benign
R1175:Rnf123	UTSW	9	108077373	missense	probably benign
R1465:Rnf123	UTSW	9	108071466	splice site	probably benign
R1502:Rnf123	UTSW	9	108068510	splice site	probably null
R1682:Rnf123	UTSW	9	108077398	missense	probably benign	0.16
R1817:Rnf123	UTSW	9	108062926	missense	probably benign	0.41
R1855:Rnf123	UTSW	9	108061791	missense	probably damaging	1.00
R2394:Rnf123	UTSW	9	108063536	missense	probably benign	0.00
R2483:Rnf123	UTSW	9	108063521	missense	probably benign	0.16
R3896:Rnf123	UTSW	9	108069103	splice site	probably benign
R3940:Rnf123	UTSW	9	108064035	splice site	probably benign
R4206:Rnf123	UTSW	9	108063963	missense	probably benign	0.01
R4641:Rnf123	UTSW	9	108058587	missense	probably damaging	1.00
R4714:Rnf123	UTSW	9	108052439	splice site	probably null
R4767:Rnf123	UTSW	9	108052089	missense	probably damaging	1.00
R4849:Rnf123	UTSW	9	108056091	missense	probably damaging	1.00
R4899:Rnf123	UTSW	9	108063680	missense	probably damaging	1.00
R5274:Rnf123	UTSW	9	108064003	frame shift	probably null
R5275:Rnf123	UTSW	9	108064003	frame shift	probably null
R5276:Rnf123	UTSW	9	108064003	frame shift	probably null
R5294:Rnf123	UTSW	9	108064003	frame shift	probably null
R5295:Rnf123	UTSW	9	108064003	frame shift	probably null
R5394:Rnf123	UTSW	9	108070731	missense	probably damaging	1.00
R5717:Rnf123	UTSW	9	108067424	missense	probably damaging	1.00
R6186:Rnf123	UTSW	9	108069958	missense	possibly damaging	0.55
R6449:Rnf123	UTSW	9	108056053	missense	probably benign	0.17
R6502:Rnf123	UTSW	9	108068332	missense	possibly damaging	0.46
R6944:Rnf123	UTSW	9	108063623	missense	probably benign	0.02
R7003:Rnf123	UTSW	9	108063683	critical splice acceptor site	probably null
R7088:Rnf123	UTSW	9	108058536	missense	probably null	1.00
R7092:Rnf123	UTSW	9	108068600	missense	probably benign	0.07
R7100:Rnf123	UTSW	9	108056639	missense	probably damaging	1.00
R7453:Rnf123	UTSW	9	108070408	splice site	probably null
R7468:Rnf123	UTSW	9	108069009	missense	probably benign	0.00
R7517:Rnf123	UTSW	9	108070274	nonsense	probably null
R7577:Rnf123	UTSW	9	108070619	missense	probably damaging	1.00
R8296:Rnf123	UTSW	9	108062890	missense	probably damaging	1.00
R8322:Rnf123	UTSW	9	108068507	missense	probably benign	0.26
R8754:Rnf123	UTSW	9	108071164	missense	probably damaging	1.00
R8783:Rnf123	UTSW	9	108069073	missense	probably benign
R9052:Rnf123	UTSW	9	108059731	missense	probably damaging	1.00
R9156:Rnf123	UTSW	9	108063028	splice site	probably benign
R9170:Rnf123	UTSW	9	108071176	missense	probably damaging	1.00
R9332:Rnf123	UTSW	9	108067505	missense	probably benign	0.00
R9385:Rnf123	UTSW	9	108052268	missense	probably benign	0.02
R9394:Rnf123	UTSW	9	108065706	missense	probably damaging	1.00
R9432:Rnf123	UTSW	9	108059809	missense	probably damaging	0.96
R9717:Rnf123	UTSW	9	108077764	missense	probably benign	0.43
Z1176:Rnf123	UTSW	9	108058395	missense	probably damaging	1.00
Z1176:Rnf123	UTSW	9	108062981	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTTCCTTAGCCTGGGACATC -3'
(R):5'- TCCAGGCAGTGCTAAGTGTG -3'

Sequencing Primer
(F):5'- TTCCTTAGCCTGGGACATCACAAC -3'
(R):5'- TAAGTGTGGAGCTGGACCC -3'

Posted On

2019-06-26