Mutagenetix > Incidental Mutations

Incidental Mutation 'R7257:Rnf123'

564345

Institutional Source

Beutler Lab

Gene Symbol

Rnf123

Ensembl Gene

ENSMUSG00000041528

Gene Name

ring finger protein 123

Synonyms

KPC1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.191) question?

Stock #

R7257 (G1)

Quality Score

219.009

Status

Validated

Chromosome

Chromosomal Location

108051534-108083346 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 108069029 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 316 (T316S)

Ref Sequence

ENSEMBL: ENSMUSP00000125745 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000174504] [ENSMUST00000178267]

Predicted Effect

probably damaging
Transcript: ENSMUST00000047746
AA Change: T316S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: T316S

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160249
AA Change: T316S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: T316S

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160649
AA Change: T316S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: T316S

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161828

Predicted Effect

probably damaging
Transcript: ENSMUST00000162355
AA Change: T316S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: T316S

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162516

Predicted Effect

probably benign
Transcript: ENSMUST00000174504

Predicted Effect

probably damaging
Transcript: ENSMUST00000178267
AA Change: T316S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: T316S

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Meta Mutation Damage Score

0.1533

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb1	A	T	6: 88,839,452	V120E	probably benign	Het
Acot11	G	A	4: 106,758,402	T284M	probably damaging	Het
Adk	G	T	14: 21,052,671	K11N	probably damaging	Het
Akr1c14	T	A	13: 4,088,966	N316K	probably benign	Het
AL732309.1	A	T	2: 25,245,839	V121D	probably benign	Het
Amh	C	A	10: 80,806,653	Q257K	probably benign	Het
Antxrl	T	G	14: 34,065,849	H276Q	probably benign	Het
Atp5o	G	A	16: 91,926,867	T105M	probably damaging	Het
Atp5s	T	C	12: 69,741,669	I114T	probably damaging	Het
Atxn2	T	G	5: 121,785,817	N734K	possibly damaging	Het
B3gat3	T	A	19: 8,925,738	V153D	probably benign	Het
Brd2	A	G	17: 34,113,822	V528A	probably damaging	Het
Camk2g	T	C	14: 20,747,839	S335G	probably benign	Het
Cbln2	T	A	18: 86,716,734	W211R	probably damaging	Het
Cry2	A	T	2: 92,412,981	I505N	possibly damaging	Het
Ddx55	T	A	5: 124,560,721	C249S	possibly damaging	Het
Dglucy	A	G	12: 100,842,738	T232A	probably damaging	Het
Dhx32	A	G	7: 133,759,477	Y76H	probably benign	Het
Dock7	T	A	4: 98,973,412	N1356I	unknown	Het
Dock8	T	A	19: 25,127,085	N710K	probably benign	Het
Dync1i2	T	A	2: 71,249,356	N391K	possibly damaging	Het
Ect2	A	G	3: 27,138,535	S420P	probably damaging	Het
Efcab5	T	A	11: 77,137,779	E242V	probably damaging	Het
Fam83g	T	A	11: 61,684,753	Y74N	probably damaging	Het
Fbxo34	T	A	14: 47,500,872		probably null	Het
Flt4	A	G	11: 49,626,009	T208A	probably benign	Het
Fxyd5	T	A	7: 31,035,151	H183L	unknown	Het
Gpr150	T	G	13: 76,056,466	D120A	probably benign	Het
Grm7	A	G	6: 110,646,118	Y84C	probably damaging	Het
Ighmbp2	A	G	19: 3,266,405	S562P	probably damaging	Het
Itga7	A	G	10: 128,944,413	Y530C	possibly damaging	Het
Itpr3	T	A	17: 27,118,561	D2448E	probably benign	Het
Mmp17	C	A	5: 129,595,633	H216Q	probably benign	Het
Mns1	C	T	9: 72,452,815	R416W	probably damaging	Het
Mog	A	G	17: 37,023,127	S25P	unknown	Het
Myh2	A	G	11: 67,181,150	K568R	possibly damaging	Het
Myh7	A	T	14: 54,972,490		probably null	Het
Mymk	A	T	2: 27,067,368	W79R	probably damaging	Het
Ncoa4	T	G	14: 32,177,369	L623R	probably damaging	Het
Oca2	G	A	7: 56,279,538		probably benign	Het
Odam	A	C	5: 87,887,545	S123R	probably benign	Het
Olfr1155	A	G	2: 87,943,571	F19S	probably damaging	Het
Olfr263	A	G	13: 21,133,257	T161A	probably benign	Het
Olfr292	T	A	7: 86,694,804	M116K	probably damaging	Het
Olfr583	T	C	7: 103,051,630	F111L	probably benign	Het
Olfr765	C	T	10: 129,046,455	V203M	probably benign	Het
Olfr816	T	A	10: 129,912,287		probably benign	Het
Ovch2	C	T	7: 107,794,433	C162Y	probably damaging	Het
Padi1	C	A	4: 140,829,471	G142C	probably damaging	Het
Pcdhga4	A	G	18: 37,687,398	I667V	probably damaging	Het
Pfas	A	T	11: 68,992,959	V624E	probably damaging	Het
Phb	A	T	11: 95,678,091	E184V	probably damaging	Het
Phlpp2	G	T	8: 109,940,188	M1116I	probably benign	Het
Pip5kl1	T	C	2: 32,580,431		probably null	Het
Pitpnm2	T	A	5: 124,125,356	I824F	possibly damaging	Het
Pla2g4c	G	A	7: 13,325,744	S2N	possibly damaging	Het
Pla2r1	A	T	2: 60,427,625		probably null	Het
Pole2	T	C	12: 69,202,910	D521G	probably damaging	Het
Ptch1	T	C	13: 63,573,294	K54E	not run	Het
Rapgef2	A	T	3: 79,082,627	L931Q	probably damaging	Het
Rassf3	G	A	10: 121,413,019	Q206*	probably null	Het
Rnf138	T	A	18: 21,008,693		probably null	Het
Sept3	G	A	15: 82,289,213	A249T	probably damaging	Het
Slc35a4	A	T	18: 36,679,616	D3V	unknown	Het
Sltm	T	A	9: 70,543,965		probably null	Het
Smarca2	C	T	19: 26,654,464	Q560*	probably null	Het
Tcl1b1	A	T	12: 105,164,531	D91V	probably damaging	Het
Tirap	A	T	9: 35,189,034	V118E	probably damaging	Het
Tlr5	T	A	1: 182,974,233	Y367*	probably null	Het
Tmcc1	A	G	6: 116,107,338	F5L	probably benign	Het
Tnxb	A	G	17: 34,716,501	M2592V	probably benign	Het
Trim66	T	A	7: 109,460,244	E931V	probably damaging	Het
Ttn	A	G	2: 76,741,094	I26485T	probably damaging	Het
Veph1	C	A	3: 66,158,282	V455L	probably benign	Het
Vmn1r125	A	T	7: 21,272,825	H216L	probably damaging	Het
Wdr17	T	A	8: 54,632,487	E1200D	probably benign	Het
Zbtb37	T	A	1: 161,032,661	N25Y	probably damaging	Het

Other mutations in Rnf123

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Rnf123	APN	9	108067395	critical splice donor site	probably null
IGL01358:Rnf123	APN	9	108069182	missense	probably damaging	1.00
IGL01464:Rnf123	APN	9	108052302	missense	probably damaging	1.00
IGL01637:Rnf123	APN	9	108058238	missense	probably damaging	1.00
IGL01669:Rnf123	APN	9	108058356	missense	probably damaging	0.98
IGL01905:Rnf123	APN	9	108071370	splice site	probably benign
IGL02070:Rnf123	APN	9	108068302	nonsense	probably null
IGL02072:Rnf123	APN	9	108068302	nonsense	probably null
IGL02073:Rnf123	APN	9	108068302	nonsense	probably null
IGL02074:Rnf123	APN	9	108066889	missense	probably damaging	1.00
IGL02079:Rnf123	APN	9	108068302	nonsense	probably null
IGL02080:Rnf123	APN	9	108068302	nonsense	probably null
IGL02231:Rnf123	APN	9	108066399	missense	probably benign	0.17
IGL02281:Rnf123	APN	9	108071452	missense	probably benign	0.01
IGL02336:Rnf123	APN	9	108061842	missense	probably damaging	1.00
IGL02543:Rnf123	APN	9	108066348	missense	probably damaging	1.00
IGL02565:Rnf123	APN	9	108052212	critical splice donor site	probably null
IGL02571:Rnf123	APN	9	108068302	nonsense	probably null
IGL02572:Rnf123	APN	9	108068302	nonsense	probably null
IGL02574:Rnf123	APN	9	108068302	nonsense	probably null
IGL02586:Rnf123	APN	9	108068302	nonsense	probably null
IGL02589:Rnf123	APN	9	108068302	nonsense	probably null
IGL02600:Rnf123	APN	9	108068302	nonsense	probably null
IGL02601:Rnf123	APN	9	108068302	nonsense	probably null
IGL02602:Rnf123	APN	9	108068302	nonsense	probably null
IGL02603:Rnf123	APN	9	108068302	nonsense	probably null
IGL02609:Rnf123	APN	9	108068302	nonsense	probably null
IGL02628:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108070789	splice site	probably benign
IGL02630:Rnf123	APN	9	108068302	nonsense	probably null
IGL02631:Rnf123	APN	9	108068302	nonsense	probably null
IGL02632:Rnf123	APN	9	108068302	nonsense	probably null
IGL02650:Rnf123	APN	9	108069748	missense	probably benign	0.29
IGL02690:Rnf123	APN	9	108068302	nonsense	probably null
IGL02691:Rnf123	APN	9	108068302	nonsense	probably null
IGL02692:Rnf123	APN	9	108068302	nonsense	probably null
IGL02693:Rnf123	APN	9	108068302	nonsense	probably null
IGL02713:Rnf123	APN	9	108068302	nonsense	probably null
IGL02736:Rnf123	APN	9	108068302	nonsense	probably null
IGL02929:Rnf123	APN	9	108069076	missense	probably benign
R1175:Rnf123	UTSW	9	108077373	missense	probably benign
R1465:Rnf123	UTSW	9	108071466	splice site	probably benign
R1502:Rnf123	UTSW	9	108068510	splice site	probably null
R1682:Rnf123	UTSW	9	108077398	missense	probably benign	0.16
R1817:Rnf123	UTSW	9	108062926	missense	probably benign	0.41
R1855:Rnf123	UTSW	9	108061791	missense	probably damaging	1.00
R2394:Rnf123	UTSW	9	108063536	missense	probably benign	0.00
R2483:Rnf123	UTSW	9	108063521	missense	probably benign	0.16
R3896:Rnf123	UTSW	9	108069103	splice site	probably benign
R3940:Rnf123	UTSW	9	108064035	splice site	probably benign
R4206:Rnf123	UTSW	9	108063963	missense	probably benign	0.01
R4641:Rnf123	UTSW	9	108058587	missense	probably damaging	1.00
R4714:Rnf123	UTSW	9	108052439	splice site	probably null
R4767:Rnf123	UTSW	9	108052089	missense	probably damaging	1.00
R4849:Rnf123	UTSW	9	108056091	missense	probably damaging	1.00
R4899:Rnf123	UTSW	9	108063680	missense	probably damaging	1.00
R5274:Rnf123	UTSW	9	108064003	frame shift	probably null
R5275:Rnf123	UTSW	9	108064003	frame shift	probably null
R5276:Rnf123	UTSW	9	108064003	frame shift	probably null
R5294:Rnf123	UTSW	9	108064003	frame shift	probably null
R5295:Rnf123	UTSW	9	108064003	frame shift	probably null
R5394:Rnf123	UTSW	9	108070731	missense	probably damaging	1.00
R5717:Rnf123	UTSW	9	108067424	missense	probably damaging	1.00
R6186:Rnf123	UTSW	9	108069958	missense	possibly damaging	0.55
R6449:Rnf123	UTSW	9	108056053	missense	probably benign	0.17
R6502:Rnf123	UTSW	9	108068332	missense	possibly damaging	0.46
R6944:Rnf123	UTSW	9	108063623	missense	probably benign	0.02
R7003:Rnf123	UTSW	9	108063683	critical splice acceptor site	probably null
R7088:Rnf123	UTSW	9	108058536	missense	probably null	1.00
R7092:Rnf123	UTSW	9	108068600	missense	probably benign	0.07
R7100:Rnf123	UTSW	9	108056639	missense	probably damaging	1.00
R7453:Rnf123	UTSW	9	108070408	splice site	probably null
R7468:Rnf123	UTSW	9	108069009	missense	probably benign	0.00
R7517:Rnf123	UTSW	9	108070274	nonsense	probably null
R7577:Rnf123	UTSW	9	108070619	missense	probably damaging	1.00
R8296:Rnf123	UTSW	9	108062890	missense	probably damaging	1.00
R8322:Rnf123	UTSW	9	108068507	missense	probably benign	0.26
R8754:Rnf123	UTSW	9	108071164	missense	probably damaging	1.00
R8783:Rnf123	UTSW	9	108069073	missense	probably benign
Z1176:Rnf123	UTSW	9	108058395	missense	probably damaging	1.00
Z1176:Rnf123	UTSW	9	108062981	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTTCCTTAGCCTGGGACATC -3'
(R):5'- TCCAGGCAGTGCTAAGTGTG -3'

Sequencing Primer
(F):5'- TTCCTTAGCCTGGGACATCACAAC -3'
(R):5'- TAAGTGTGGAGCTGGACCC -3'

Posted On

2019-06-26