Incidental Mutation 'R7257:Rnf123'
ID 564345
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Name ring finger protein 123
Synonyms KPC1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock # R7257 (G1)
Quality Score 219.009
Status Validated
Chromosome 9
Chromosomal Location 108051534-108083346 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 108069029 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 316 (T316S)
Ref Sequence ENSEMBL: ENSMUSP00000125745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000174504] [ENSMUST00000178267]
AlphaFold Q5XPI3
Predicted Effect probably damaging
Transcript: ENSMUST00000047746
AA Change: T316S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: T316S

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160249
AA Change: T316S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: T316S

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160649
AA Change: T316S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: T316S

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161828
Predicted Effect probably damaging
Transcript: ENSMUST00000162355
AA Change: T316S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: T316S

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162516
Predicted Effect probably benign
Transcript: ENSMUST00000174504
Predicted Effect probably damaging
Transcript: ENSMUST00000178267
AA Change: T316S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: T316S

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Meta Mutation Damage Score 0.1533 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A T 6: 88,839,452 V120E probably benign Het
Acot11 G A 4: 106,758,402 T284M probably damaging Het
Adk G T 14: 21,052,671 K11N probably damaging Het
Akr1c14 T A 13: 4,088,966 N316K probably benign Het
AL732309.1 A T 2: 25,245,839 V121D probably benign Het
Amh C A 10: 80,806,653 Q257K probably benign Het
Antxrl T G 14: 34,065,849 H276Q probably benign Het
Atp5o G A 16: 91,926,867 T105M probably damaging Het
Atp5s T C 12: 69,741,669 I114T probably damaging Het
Atxn2 T G 5: 121,785,817 N734K possibly damaging Het
B3gat3 T A 19: 8,925,738 V153D probably benign Het
Brd2 A G 17: 34,113,822 V528A probably damaging Het
Camk2g T C 14: 20,747,839 S335G probably benign Het
Cbln2 T A 18: 86,716,734 W211R probably damaging Het
Cry2 A T 2: 92,412,981 I505N possibly damaging Het
Ddx55 T A 5: 124,560,721 C249S possibly damaging Het
Dglucy A G 12: 100,842,738 T232A probably damaging Het
Dhx32 A G 7: 133,759,477 Y76H probably benign Het
Dock7 T A 4: 98,973,412 N1356I unknown Het
Dock8 T A 19: 25,127,085 N710K probably benign Het
Dync1i2 T A 2: 71,249,356 N391K possibly damaging Het
Ect2 A G 3: 27,138,535 S420P probably damaging Het
Efcab5 T A 11: 77,137,779 E242V probably damaging Het
Fam83g T A 11: 61,684,753 Y74N probably damaging Het
Fbxo34 T A 14: 47,500,872 probably null Het
Flt4 A G 11: 49,626,009 T208A probably benign Het
Fxyd5 T A 7: 31,035,151 H183L unknown Het
Gpr150 T G 13: 76,056,466 D120A probably benign Het
Grm7 A G 6: 110,646,118 Y84C probably damaging Het
Ighmbp2 A G 19: 3,266,405 S562P probably damaging Het
Itga7 A G 10: 128,944,413 Y530C possibly damaging Het
Itpr3 T A 17: 27,118,561 D2448E probably benign Het
Mmp17 C A 5: 129,595,633 H216Q probably benign Het
Mns1 C T 9: 72,452,815 R416W probably damaging Het
Mog A G 17: 37,023,127 S25P unknown Het
Myh2 A G 11: 67,181,150 K568R possibly damaging Het
Myh7 A T 14: 54,972,490 probably null Het
Mymk A T 2: 27,067,368 W79R probably damaging Het
Ncoa4 T G 14: 32,177,369 L623R probably damaging Het
Oca2 G A 7: 56,279,538 probably benign Het
Odam A C 5: 87,887,545 S123R probably benign Het
Olfr1155 A G 2: 87,943,571 F19S probably damaging Het
Olfr263 A G 13: 21,133,257 T161A probably benign Het
Olfr292 T A 7: 86,694,804 M116K probably damaging Het
Olfr583 T C 7: 103,051,630 F111L probably benign Het
Olfr765 C T 10: 129,046,455 V203M probably benign Het
Olfr816 T A 10: 129,912,287 probably benign Het
Ovch2 C T 7: 107,794,433 C162Y probably damaging Het
Padi1 C A 4: 140,829,471 G142C probably damaging Het
Pcdhga4 A G 18: 37,687,398 I667V probably damaging Het
Pfas A T 11: 68,992,959 V624E probably damaging Het
Phb A T 11: 95,678,091 E184V probably damaging Het
Phlpp2 G T 8: 109,940,188 M1116I probably benign Het
Pip5kl1 T C 2: 32,580,431 probably null Het
Pitpnm2 T A 5: 124,125,356 I824F possibly damaging Het
Pla2g4c G A 7: 13,325,744 S2N possibly damaging Het
Pla2r1 A T 2: 60,427,625 probably null Het
Pole2 T C 12: 69,202,910 D521G probably damaging Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rapgef2 A T 3: 79,082,627 L931Q probably damaging Het
Rassf3 G A 10: 121,413,019 Q206* probably null Het
Rnf138 T A 18: 21,008,693 probably null Het
Sept3 G A 15: 82,289,213 A249T probably damaging Het
Slc35a4 A T 18: 36,679,616 D3V unknown Het
Sltm T A 9: 70,543,965 probably null Het
Smarca2 C T 19: 26,654,464 Q560* probably null Het
Tcl1b1 A T 12: 105,164,531 D91V probably damaging Het
Tirap A T 9: 35,189,034 V118E probably damaging Het
Tlr5 T A 1: 182,974,233 Y367* probably null Het
Tmcc1 A G 6: 116,107,338 F5L probably benign Het
Tnxb A G 17: 34,716,501 M2592V probably benign Het
Trim66 T A 7: 109,460,244 E931V probably damaging Het
Ttn A G 2: 76,741,094 I26485T probably damaging Het
Veph1 C A 3: 66,158,282 V455L probably benign Het
Vmn1r125 A T 7: 21,272,825 H216L probably damaging Het
Wdr17 T A 8: 54,632,487 E1200D probably benign Het
Zbtb37 T A 1: 161,032,661 N25Y probably damaging Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 108067395 critical splice donor site probably null
IGL01358:Rnf123 APN 9 108069182 missense probably damaging 1.00
IGL01464:Rnf123 APN 9 108052302 missense probably damaging 1.00
IGL01637:Rnf123 APN 9 108058238 missense probably damaging 1.00
IGL01669:Rnf123 APN 9 108058356 missense probably damaging 0.98
IGL01905:Rnf123 APN 9 108071370 splice site probably benign
IGL02070:Rnf123 APN 9 108068302 nonsense probably null
IGL02072:Rnf123 APN 9 108068302 nonsense probably null
IGL02073:Rnf123 APN 9 108068302 nonsense probably null
IGL02074:Rnf123 APN 9 108066889 missense probably damaging 1.00
IGL02079:Rnf123 APN 9 108068302 nonsense probably null
IGL02080:Rnf123 APN 9 108068302 nonsense probably null
IGL02231:Rnf123 APN 9 108066399 missense probably benign 0.17
IGL02281:Rnf123 APN 9 108071452 missense probably benign 0.01
IGL02336:Rnf123 APN 9 108061842 missense probably damaging 1.00
IGL02543:Rnf123 APN 9 108066348 missense probably damaging 1.00
IGL02565:Rnf123 APN 9 108052212 critical splice donor site probably null
IGL02571:Rnf123 APN 9 108068302 nonsense probably null
IGL02572:Rnf123 APN 9 108068302 nonsense probably null
IGL02574:Rnf123 APN 9 108068302 nonsense probably null
IGL02586:Rnf123 APN 9 108068302 nonsense probably null
IGL02589:Rnf123 APN 9 108068302 nonsense probably null
IGL02600:Rnf123 APN 9 108068302 nonsense probably null
IGL02601:Rnf123 APN 9 108068302 nonsense probably null
IGL02602:Rnf123 APN 9 108068302 nonsense probably null
IGL02603:Rnf123 APN 9 108068302 nonsense probably null
IGL02609:Rnf123 APN 9 108068302 nonsense probably null
IGL02628:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108070789 splice site probably benign
IGL02630:Rnf123 APN 9 108068302 nonsense probably null
IGL02631:Rnf123 APN 9 108068302 nonsense probably null
IGL02632:Rnf123 APN 9 108068302 nonsense probably null
IGL02650:Rnf123 APN 9 108069748 missense probably benign 0.29
IGL02690:Rnf123 APN 9 108068302 nonsense probably null
IGL02691:Rnf123 APN 9 108068302 nonsense probably null
IGL02692:Rnf123 APN 9 108068302 nonsense probably null
IGL02693:Rnf123 APN 9 108068302 nonsense probably null
IGL02713:Rnf123 APN 9 108068302 nonsense probably null
IGL02736:Rnf123 APN 9 108068302 nonsense probably null
IGL02929:Rnf123 APN 9 108069076 missense probably benign
R1175:Rnf123 UTSW 9 108077373 missense probably benign
R1465:Rnf123 UTSW 9 108071466 splice site probably benign
R1502:Rnf123 UTSW 9 108068510 splice site probably null
R1682:Rnf123 UTSW 9 108077398 missense probably benign 0.16
R1817:Rnf123 UTSW 9 108062926 missense probably benign 0.41
R1855:Rnf123 UTSW 9 108061791 missense probably damaging 1.00
R2394:Rnf123 UTSW 9 108063536 missense probably benign 0.00
R2483:Rnf123 UTSW 9 108063521 missense probably benign 0.16
R3896:Rnf123 UTSW 9 108069103 splice site probably benign
R3940:Rnf123 UTSW 9 108064035 splice site probably benign
R4206:Rnf123 UTSW 9 108063963 missense probably benign 0.01
R4641:Rnf123 UTSW 9 108058587 missense probably damaging 1.00
R4714:Rnf123 UTSW 9 108052439 splice site probably null
R4767:Rnf123 UTSW 9 108052089 missense probably damaging 1.00
R4849:Rnf123 UTSW 9 108056091 missense probably damaging 1.00
R4899:Rnf123 UTSW 9 108063680 missense probably damaging 1.00
R5274:Rnf123 UTSW 9 108064003 frame shift probably null
R5275:Rnf123 UTSW 9 108064003 frame shift probably null
R5276:Rnf123 UTSW 9 108064003 frame shift probably null
R5294:Rnf123 UTSW 9 108064003 frame shift probably null
R5295:Rnf123 UTSW 9 108064003 frame shift probably null
R5394:Rnf123 UTSW 9 108070731 missense probably damaging 1.00
R5717:Rnf123 UTSW 9 108067424 missense probably damaging 1.00
R6186:Rnf123 UTSW 9 108069958 missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 108056053 missense probably benign 0.17
R6502:Rnf123 UTSW 9 108068332 missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 108063623 missense probably benign 0.02
R7003:Rnf123 UTSW 9 108063683 critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 108058536 missense probably null 1.00
R7092:Rnf123 UTSW 9 108068600 missense probably benign 0.07
R7100:Rnf123 UTSW 9 108056639 missense probably damaging 1.00
R7453:Rnf123 UTSW 9 108070408 splice site probably null
R7468:Rnf123 UTSW 9 108069009 missense probably benign 0.00
R7517:Rnf123 UTSW 9 108070274 nonsense probably null
R7577:Rnf123 UTSW 9 108070619 missense probably damaging 1.00
R8296:Rnf123 UTSW 9 108062890 missense probably damaging 1.00
R8322:Rnf123 UTSW 9 108068507 missense probably benign 0.26
R8754:Rnf123 UTSW 9 108071164 missense probably damaging 1.00
R8783:Rnf123 UTSW 9 108069073 missense probably benign
R9052:Rnf123 UTSW 9 108059731 missense probably damaging 1.00
R9156:Rnf123 UTSW 9 108063028 splice site probably benign
R9170:Rnf123 UTSW 9 108071176 missense probably damaging 1.00
R9332:Rnf123 UTSW 9 108067505 missense probably benign 0.00
R9385:Rnf123 UTSW 9 108052268 missense probably benign 0.02
R9394:Rnf123 UTSW 9 108065706 missense probably damaging 1.00
R9432:Rnf123 UTSW 9 108059809 missense probably damaging 0.96
Z1176:Rnf123 UTSW 9 108058395 missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 108062981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTCCTTAGCCTGGGACATC -3'
(R):5'- TCCAGGCAGTGCTAAGTGTG -3'

Sequencing Primer
(F):5'- TTCCTTAGCCTGGGACATCACAAC -3'
(R):5'- TAAGTGTGGAGCTGGACCC -3'
Posted On 2019-06-26