Incidental Mutation 'R7257:Amh'
ID 564346
Institutional Source Beutler Lab
Gene Symbol Amh
Ensembl Gene ENSMUSG00000035262
Gene Name anti-Mullerian hormone
Synonyms MIS, Mullerian inhibiting substance
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock # R7257 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 80805243-80807648 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 80806653 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 257 (Q257K)
Ref Sequence ENSEMBL: ENSMUSP00000043153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020435] [ENSMUST00000036016] [ENSMUST00000147440] [ENSMUST00000148665] [ENSMUST00000151928] [ENSMUST00000180438] [ENSMUST00000181039] [ENSMUST00000181945]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000020435
SMART Domains Protein: ENSMUSP00000020435
Gene: ENSMUSG00000020216

DomainStartEndE-ValueType
low complexity region 52 77 N/A INTRINSIC
Pfam:JSRP 79 138 1e-29 PFAM
low complexity region 145 158 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
low complexity region 205 230 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036016
AA Change: Q257K

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000043153
Gene: ENSMUSG00000035262
AA Change: Q257K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 38 52 N/A INTRINSIC
Pfam:AMH_N 75 439 3e-133 PFAM
TGFB 456 554 8.57e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147440
SMART Domains Protein: ENSMUSP00000116478
Gene: ENSMUSG00000020211

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
Blast:CactinC_cactus 41 67 1e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148665
SMART Domains Protein: ENSMUSP00000117160
Gene: ENSMUSG00000020211

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
ZnF_U1 51 85 5.02e-9 SMART
ZnF_C2H2 54 78 1.23e1 SMART
CactinC_cactus 91 219 8.29e-35 SMART
low complexity region 300 318 N/A INTRINSIC
low complexity region 320 420 N/A INTRINSIC
low complexity region 423 452 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151928
SMART Domains Protein: ENSMUSP00000114164
Gene: ENSMUSG00000020211

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
ZnF_U1 51 85 5.02e-9 SMART
ZnF_C2H2 54 78 1.23e1 SMART
CactinC_cactus 91 194 1.26e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180438
SMART Domains Protein: ENSMUSP00000137701
Gene: ENSMUSG00000020216

DomainStartEndE-ValueType
low complexity region 23 48 N/A INTRINSIC
Pfam:JSRP 49 78 3.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181039
SMART Domains Protein: ENSMUSP00000137666
Gene: ENSMUSG00000020216

DomainStartEndE-ValueType
low complexity region 92 117 N/A INTRINSIC
Pfam:JSRP 118 179 1e-31 PFAM
low complexity region 185 198 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 245 270 N/A INTRINSIC
low complexity region 313 324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181945
SMART Domains Protein: ENSMUSP00000137960
Gene: ENSMUSG00000020216

DomainStartEndE-ValueType
transmembrane domain 53 75 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate N- and C-terminal cleavage products that homodimerize and associate to form a biologically active noncovalent complex. This complex binds to the anti-Mullerian hormone receptor type 2 and causes the regression of Mullerian ducts in the male embryo that would otherwise differentiate into the uterus and fallopian tubes. This protein also plays a role in Leydig cell differentiation and function and follicular development in adult females. Homozygous knockout male mice develop female reproductive organs and are often sterile, while homozygous knockout female mice exhibit premature depletion of primordial follicles. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mutant males have a complete male reproductive tract and functional sperm, but also uterus and oviducts. Most are infertile due to female organs blocking sperm transfer. Females are fertile with enlarged ovaries and atypical follicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A T 6: 88,839,452 V120E probably benign Het
Acot11 G A 4: 106,758,402 T284M probably damaging Het
Adk G T 14: 21,052,671 K11N probably damaging Het
Akr1c14 T A 13: 4,088,966 N316K probably benign Het
AL732309.1 A T 2: 25,245,839 V121D probably benign Het
Antxrl T G 14: 34,065,849 H276Q probably benign Het
Atp5o G A 16: 91,926,867 T105M probably damaging Het
Atp5s T C 12: 69,741,669 I114T probably damaging Het
Atxn2 T G 5: 121,785,817 N734K possibly damaging Het
B3gat3 T A 19: 8,925,738 V153D probably benign Het
Brd2 A G 17: 34,113,822 V528A probably damaging Het
Camk2g T C 14: 20,747,839 S335G probably benign Het
Cbln2 T A 18: 86,716,734 W211R probably damaging Het
Cry2 A T 2: 92,412,981 I505N possibly damaging Het
Ddx55 T A 5: 124,560,721 C249S possibly damaging Het
Dglucy A G 12: 100,842,738 T232A probably damaging Het
Dhx32 A G 7: 133,759,477 Y76H probably benign Het
Dock7 T A 4: 98,973,412 N1356I unknown Het
Dock8 T A 19: 25,127,085 N710K probably benign Het
Dync1i2 T A 2: 71,249,356 N391K possibly damaging Het
Ect2 A G 3: 27,138,535 S420P probably damaging Het
Efcab5 T A 11: 77,137,779 E242V probably damaging Het
Fam83g T A 11: 61,684,753 Y74N probably damaging Het
Fbxo34 T A 14: 47,500,872 probably null Het
Flt4 A G 11: 49,626,009 T208A probably benign Het
Fxyd5 T A 7: 31,035,151 H183L unknown Het
Gpr150 T G 13: 76,056,466 D120A probably benign Het
Grm7 A G 6: 110,646,118 Y84C probably damaging Het
Ighmbp2 A G 19: 3,266,405 S562P probably damaging Het
Itga7 A G 10: 128,944,413 Y530C possibly damaging Het
Itpr3 T A 17: 27,118,561 D2448E probably benign Het
Mmp17 C A 5: 129,595,633 H216Q probably benign Het
Mns1 C T 9: 72,452,815 R416W probably damaging Het
Mog A G 17: 37,023,127 S25P unknown Het
Myh2 A G 11: 67,181,150 K568R possibly damaging Het
Myh7 A T 14: 54,972,490 probably null Het
Mymk A T 2: 27,067,368 W79R probably damaging Het
Ncoa4 T G 14: 32,177,369 L623R probably damaging Het
Oca2 G A 7: 56,279,538 probably benign Het
Odam A C 5: 87,887,545 S123R probably benign Het
Olfr1155 A G 2: 87,943,571 F19S probably damaging Het
Olfr263 A G 13: 21,133,257 T161A probably benign Het
Olfr292 T A 7: 86,694,804 M116K probably damaging Het
Olfr583 T C 7: 103,051,630 F111L probably benign Het
Olfr765 C T 10: 129,046,455 V203M probably benign Het
Olfr816 T A 10: 129,912,287 probably benign Het
Ovch2 C T 7: 107,794,433 C162Y probably damaging Het
Padi1 C A 4: 140,829,471 G142C probably damaging Het
Pcdhga4 A G 18: 37,687,398 I667V probably damaging Het
Pfas A T 11: 68,992,959 V624E probably damaging Het
Phb A T 11: 95,678,091 E184V probably damaging Het
Phlpp2 G T 8: 109,940,188 M1116I probably benign Het
Pip5kl1 T C 2: 32,580,431 probably null Het
Pitpnm2 T A 5: 124,125,356 I824F possibly damaging Het
Pla2g4c G A 7: 13,325,744 S2N possibly damaging Het
Pla2r1 A T 2: 60,427,625 probably null Het
Pole2 T C 12: 69,202,910 D521G probably damaging Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rapgef2 A T 3: 79,082,627 L931Q probably damaging Het
Rassf3 G A 10: 121,413,019 Q206* probably null Het
Rnf123 T A 9: 108,069,029 T316S probably damaging Het
Rnf138 T A 18: 21,008,693 probably null Het
Sept3 G A 15: 82,289,213 A249T probably damaging Het
Slc35a4 A T 18: 36,679,616 D3V unknown Het
Sltm T A 9: 70,543,965 probably null Het
Smarca2 C T 19: 26,654,464 Q560* probably null Het
Tcl1b1 A T 12: 105,164,531 D91V probably damaging Het
Tirap A T 9: 35,189,034 V118E probably damaging Het
Tlr5 T A 1: 182,974,233 Y367* probably null Het
Tmcc1 A G 6: 116,107,338 F5L probably benign Het
Tnxb A G 17: 34,716,501 M2592V probably benign Het
Trim66 T A 7: 109,460,244 E931V probably damaging Het
Ttn A G 2: 76,741,094 I26485T probably damaging Het
Veph1 C A 3: 66,158,282 V455L probably benign Het
Vmn1r125 A T 7: 21,272,825 H216L probably damaging Het
Wdr17 T A 8: 54,632,487 E1200D probably benign Het
Zbtb37 T A 1: 161,032,661 N25Y probably damaging Het
Other mutations in Amh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Amh APN 10 80805408 missense probably damaging 0.98
R0553:Amh UTSW 10 80806176 unclassified probably benign
R1195:Amh UTSW 10 80805585 frame shift probably null
R1195:Amh UTSW 10 80805585 frame shift probably null
R1750:Amh UTSW 10 80805585 frame shift probably null
R1765:Amh UTSW 10 80805585 frame shift probably null
R1974:Amh UTSW 10 80806416 missense probably benign 0.00
R1998:Amh UTSW 10 80805585 frame shift probably null
R4425:Amh UTSW 10 80806921 missense probably damaging 1.00
R4554:Amh UTSW 10 80807051 missense probably benign
R6007:Amh UTSW 10 80805471 missense probably benign
R6989:Amh UTSW 10 80805504 missense probably benign
R7722:Amh UTSW 10 80806624 missense probably benign 0.14
R8398:Amh UTSW 10 80805560 missense probably benign 0.00
R9042:Amh UTSW 10 80806609 missense possibly damaging 0.68
Z1177:Amh UTSW 10 80807586 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTGGAAGGAAGCTGCCCTTAAC -3'
(R):5'- AGTTGCGTGTTCGAAGCCTG -3'

Sequencing Primer
(F):5'- GCTGCCCTTAACCCCAG -3'
(R):5'- TTCGAAGCCTGGGTCAGAG -3'
Posted On 2019-06-26