Incidental Mutation 'R7257:Myh2'
ID564353
Institutional Source Beutler Lab
Gene Symbol Myh2
Ensembl Gene ENSMUSG00000033196
Gene Namemyosin, heavy polypeptide 2, skeletal muscle, adult
SynonymsMHC2A, Myhs-f, Myhsf1, Myhs-f1, MyHC-IIa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R7257 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location67171027-67197517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67181150 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 568 (K568R)
Ref Sequence ENSEMBL: ENSMUSP00000018641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018641] [ENSMUST00000170159]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018641
AA Change: K568R

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196
AA Change: K568R

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170159
AA Change: K568R

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196
AA Change: K568R

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A T 6: 88,839,452 V120E probably benign Het
Acot11 G A 4: 106,758,402 T284M probably damaging Het
Adk G T 14: 21,052,671 K11N probably damaging Het
Akr1c14 T A 13: 4,088,966 N316K probably benign Het
AL732309.1 A T 2: 25,245,839 V121D probably benign Het
Amh C A 10: 80,806,653 Q257K probably benign Het
Antxrl T G 14: 34,065,849 H276Q probably benign Het
Atp5o G A 16: 91,926,867 T105M probably damaging Het
Atp5s T C 12: 69,741,669 I114T probably damaging Het
Atxn2 T G 5: 121,785,817 N734K possibly damaging Het
B3gat3 T A 19: 8,925,738 V153D probably benign Het
Brd2 A G 17: 34,113,822 V528A probably damaging Het
Camk2g T C 14: 20,747,839 S335G probably benign Het
Cbln2 T A 18: 86,716,734 W211R probably damaging Het
Cry2 A T 2: 92,412,981 I505N possibly damaging Het
Ddx55 T A 5: 124,560,721 C249S possibly damaging Het
Dglucy A G 12: 100,842,738 T232A probably damaging Het
Dhx32 A G 7: 133,759,477 Y76H probably benign Het
Dock7 T A 4: 98,973,412 N1356I unknown Het
Dock8 T A 19: 25,127,085 N710K probably benign Het
Dync1i2 T A 2: 71,249,356 N391K possibly damaging Het
Ect2 A G 3: 27,138,535 S420P probably damaging Het
Efcab5 T A 11: 77,137,779 E242V probably damaging Het
Fam83g T A 11: 61,684,753 Y74N probably damaging Het
Fbxo34 T A 14: 47,500,872 probably null Het
Flt4 A G 11: 49,626,009 T208A probably benign Het
Fxyd5 T A 7: 31,035,151 H183L unknown Het
Gpr150 T G 13: 76,056,466 D120A probably benign Het
Grm7 A G 6: 110,646,118 Y84C probably damaging Het
Ighmbp2 A G 19: 3,266,405 S562P probably damaging Het
Itga7 A G 10: 128,944,413 Y530C possibly damaging Het
Itpr3 T A 17: 27,118,561 D2448E probably benign Het
Mmp17 C A 5: 129,595,633 H216Q probably benign Het
Mns1 C T 9: 72,452,815 R416W probably damaging Het
Mog A G 17: 37,023,127 S25P unknown Het
Myh7 A T 14: 54,972,490 probably null Het
Mymk A T 2: 27,067,368 W79R probably damaging Het
Ncoa4 T G 14: 32,177,369 L623R probably damaging Het
Oca2 G A 7: 56,279,538 probably benign Het
Odam A C 5: 87,887,545 S123R probably benign Het
Olfr1155 A G 2: 87,943,571 F19S probably damaging Het
Olfr263 A G 13: 21,133,257 T161A probably benign Het
Olfr292 T A 7: 86,694,804 M116K probably damaging Het
Olfr583 T C 7: 103,051,630 F111L probably benign Het
Olfr765 C T 10: 129,046,455 V203M probably benign Het
Olfr816 T A 10: 129,912,287 probably benign Het
Ovch2 C T 7: 107,794,433 C162Y probably damaging Het
Padi1 C A 4: 140,829,471 G142C probably damaging Het
Pcdhga4 A G 18: 37,687,398 I667V probably damaging Het
Pfas A T 11: 68,992,959 V624E probably damaging Het
Phb A T 11: 95,678,091 E184V probably damaging Het
Phlpp2 G T 8: 109,940,188 M1116I probably benign Het
Pip5kl1 T C 2: 32,580,431 probably null Het
Pitpnm2 T A 5: 124,125,356 I824F possibly damaging Het
Pla2g4c G A 7: 13,325,744 S2N possibly damaging Het
Pla2r1 A T 2: 60,427,625 probably null Het
Pole2 T C 12: 69,202,910 D521G probably damaging Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rapgef2 A T 3: 79,082,627 L931Q probably damaging Het
Rassf3 G A 10: 121,413,019 Q206* probably null Het
Rnf123 T A 9: 108,069,029 T316S probably damaging Het
Rnf138 T A 18: 21,008,693 probably null Het
Sept3 G A 15: 82,289,213 A249T probably damaging Het
Slc35a4 A T 18: 36,679,616 D3V unknown Het
Sltm T A 9: 70,543,965 probably null Het
Smarca2 C T 19: 26,654,464 Q560* probably null Het
Tcl1b1 A T 12: 105,164,531 D91V probably damaging Het
Tirap A T 9: 35,189,034 V118E probably damaging Het
Tlr5 T A 1: 182,974,233 Y367* probably null Het
Tmcc1 A G 6: 116,107,338 F5L probably benign Het
Tnxb A G 17: 34,716,501 M2592V probably benign Het
Trim66 T A 7: 109,460,244 E931V probably damaging Het
Ttn A G 2: 76,741,094 I26485T probably damaging Het
Veph1 C A 3: 66,158,282 V455L probably benign Het
Vmn1r125 A T 7: 21,272,825 H216L probably damaging Het
Wdr17 T A 8: 54,632,487 E1200D probably benign Het
Zbtb37 T A 1: 161,032,661 N25Y probably damaging Het
Other mutations in Myh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Myh2 APN 11 67185233 missense possibly damaging 0.88
IGL00330:Myh2 APN 11 67193440 missense probably benign 0.06
IGL00423:Myh2 APN 11 67197345 missense probably benign
IGL00429:Myh2 APN 11 67180790 nonsense probably null
IGL00465:Myh2 APN 11 67178833 splice site probably benign
IGL00671:Myh2 APN 11 67193357 missense probably damaging 0.97
IGL00773:Myh2 APN 11 67194421 missense probably benign
IGL00821:Myh2 APN 11 67197397 utr 3 prime probably benign
IGL00900:Myh2 APN 11 67179384 missense probably damaging 1.00
IGL01374:Myh2 APN 11 67177424 missense probably benign 0.05
IGL01613:Myh2 APN 11 67197344 missense probably benign 0.01
IGL01845:Myh2 APN 11 67193034 missense probably benign 0.02
IGL01900:Myh2 APN 11 67183783 missense probably benign 0.01
IGL01936:Myh2 APN 11 67191773 missense possibly damaging 0.94
IGL02129:Myh2 APN 11 67185258 missense probably benign 0.05
IGL02172:Myh2 APN 11 67189052 missense possibly damaging 0.78
IGL02554:Myh2 APN 11 67189165 missense probably benign 0.00
IGL02578:Myh2 APN 11 67186691 missense probably benign 0.33
IGL03075:Myh2 APN 11 67180836 missense probably benign 0.39
IGL03078:Myh2 APN 11 67190430 missense probably benign
IGL03117:Myh2 APN 11 67180884 missense possibly damaging 0.91
IGL03255:Myh2 APN 11 67193225 missense probably damaging 1.00
IGL03266:Myh2 APN 11 67176324 missense probably benign
IGL03366:Myh2 APN 11 67183523 missense probably damaging 1.00
IGL03412:Myh2 APN 11 67189569 missense probably benign 0.04
limp UTSW 11 67192504 missense probably damaging 1.00
noodle UTSW 11 67186612 missense probably benign
PIT4403001:Myh2 UTSW 11 67186707 missense probably benign 0.22
PIT4508001:Myh2 UTSW 11 67185505 missense probably benign 0.00
PIT4677001:Myh2 UTSW 11 67181992 missense probably benign
R0039:Myh2 UTSW 11 67178277 missense probably damaging 1.00
R0347:Myh2 UTSW 11 67185304 splice site probably benign
R0389:Myh2 UTSW 11 67180821 missense probably damaging 1.00
R0400:Myh2 UTSW 11 67192598 splice site probably benign
R0512:Myh2 UTSW 11 67188678 missense probably damaging 1.00
R0555:Myh2 UTSW 11 67178967 missense probably damaging 1.00
R0746:Myh2 UTSW 11 67173431 missense probably benign 0.00
R0842:Myh2 UTSW 11 67179524 missense possibly damaging 0.83
R0893:Myh2 UTSW 11 67186508 missense possibly damaging 0.82
R1218:Myh2 UTSW 11 67192525 missense probably damaging 0.99
R1264:Myh2 UTSW 11 67180778 missense probably damaging 0.96
R1398:Myh2 UTSW 11 67185287 missense probably benign 0.14
R1774:Myh2 UTSW 11 67173474 missense possibly damaging 0.96
R1800:Myh2 UTSW 11 67188938 missense probably damaging 0.99
R1829:Myh2 UTSW 11 67176559 missense probably damaging 0.98
R1840:Myh2 UTSW 11 67186487 missense probably benign 0.16
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1969:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1971:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1985:Myh2 UTSW 11 67180914 missense possibly damaging 0.65
R2021:Myh2 UTSW 11 67191719 missense probably damaging 1.00
R2029:Myh2 UTSW 11 67194625 missense possibly damaging 0.85
R2057:Myh2 UTSW 11 67188839 critical splice donor site probably null
R2080:Myh2 UTSW 11 67174941 critical splice acceptor site probably null
R2142:Myh2 UTSW 11 67189332 missense probably damaging 1.00
R2215:Myh2 UTSW 11 67191737 missense probably benign 0.35
R2225:Myh2 UTSW 11 67193729 missense probably benign
R2274:Myh2 UTSW 11 67190358 missense possibly damaging 0.84
R3018:Myh2 UTSW 11 67179584 missense possibly damaging 0.67
R3113:Myh2 UTSW 11 67185186 missense probably damaging 1.00
R3703:Myh2 UTSW 11 67189601 missense probably benign 0.01
R4022:Myh2 UTSW 11 67179404 nonsense probably null
R4081:Myh2 UTSW 11 67190430 missense probably benign 0.11
R4191:Myh2 UTSW 11 67177400 missense possibly damaging 0.81
R4291:Myh2 UTSW 11 67181159 missense probably benign 0.01
R4292:Myh2 UTSW 11 67194897 missense possibly damaging 0.46
R4424:Myh2 UTSW 11 67192725 missense probably benign 0.01
R4524:Myh2 UTSW 11 67176270 missense probably damaging 1.00
R4578:Myh2 UTSW 11 67173258 missense possibly damaging 0.85
R4597:Myh2 UTSW 11 67189418 missense probably benign 0.01
R4641:Myh2 UTSW 11 67194694 missense probably damaging 1.00
R4672:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4673:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4804:Myh2 UTSW 11 67186502 missense possibly damaging 0.78
R4818:Myh2 UTSW 11 67176255 missense probably damaging 1.00
R4943:Myh2 UTSW 11 67197317 missense probably damaging 1.00
R4958:Myh2 UTSW 11 67192959 missense possibly damaging 0.83
R5139:Myh2 UTSW 11 67179348 missense probably damaging 1.00
R5239:Myh2 UTSW 11 67192443 missense probably benign 0.00
R5306:Myh2 UTSW 11 67186556 missense probably damaging 1.00
R5492:Myh2 UTSW 11 67180875 missense probably benign 0.20
R5503:Myh2 UTSW 11 67173449 missense probably benign
R5646:Myh2 UTSW 11 67188812 missense probably benign 0.07
R5750:Myh2 UTSW 11 67191428 missense probably benign
R5806:Myh2 UTSW 11 67181315 missense probably damaging 0.98
R5878:Myh2 UTSW 11 67192504 missense probably damaging 1.00
R5892:Myh2 UTSW 11 67185176 nonsense probably null
R5898:Myh2 UTSW 11 67192719 missense possibly damaging 0.51
R6154:Myh2 UTSW 11 67186612 missense probably benign
R6156:Myh2 UTSW 11 67181053 missense probably damaging 0.98
R6236:Myh2 UTSW 11 67190331 missense probably benign 0.00
R6349:Myh2 UTSW 11 67193003 missense probably benign 0.04
R6441:Myh2 UTSW 11 67194611 missense probably benign 0.00
R6548:Myh2 UTSW 11 67186612 missense probably benign
R6681:Myh2 UTSW 11 67178348 missense probably damaging 1.00
R6907:Myh2 UTSW 11 67193741 missense probably damaging 1.00
R6925:Myh2 UTSW 11 67193218 missense probably benign 0.00
R6969:Myh2 UTSW 11 67197266 missense probably benign
R7172:Myh2 UTSW 11 67188701 missense probably benign 0.00
R7286:Myh2 UTSW 11 67188369 missense probably benign 0.23
R7323:Myh2 UTSW 11 67197365 missense probably benign
R7396:Myh2 UTSW 11 67194728 critical splice donor site probably null
R7468:Myh2 UTSW 11 67192542 missense probably benign 0.01
R7585:Myh2 UTSW 11 67179411 critical splice donor site probably null
R7709:Myh2 UTSW 11 67194864 missense probably benign 0.00
X0026:Myh2 UTSW 11 67175022 missense probably benign 0.10
X0065:Myh2 UTSW 11 67176259 missense probably damaging 0.99
Z1088:Myh2 UTSW 11 67180763 critical splice acceptor site probably benign
Z1088:Myh2 UTSW 11 67191449 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATCGAGAAGGTATCCATCCCG -3'
(R):5'- CAGTTTGTGCCCCAGAGAAGAG -3'

Sequencing Primer
(F):5'- AAGGTATCCATCCCGCTCCG -3'
(R):5'- GAGATAAGCCAGAGTTTTCACTG -3'
Posted On2019-06-26