Incidental Mutation 'R7257:Adk'
ID 564366
Institutional Source Beutler Lab
Gene Symbol Adk
Ensembl Gene ENSMUSG00000039197
Gene Name adenosine kinase
Synonyms AK, 2310026J05Rik, 5033405D03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7257 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 21052574-21448569 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 21052671 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 11 (K11N)
Ref Sequence ENSEMBL: ENSMUSP00000047665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022371] [ENSMUST00000045376] [ENSMUST00000126536] [ENSMUST00000130291] [ENSMUST00000130370] [ENSMUST00000154460] [ENSMUST00000223915] [ENSMUST00000224016] [ENSMUST00000224899]
AlphaFold P55264
Predicted Effect probably benign
Transcript: ENSMUST00000022371
SMART Domains Protein: ENSMUSP00000022371
Gene: ENSMUSG00000021824

DomainStartEndE-ValueType
SCOP:d1gw5m2 1 96 1e-23 SMART
Pfam:Adap_comp_sub 111 364 9.1e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000045376
AA Change: K11N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047665
Gene: ENSMUSG00000039197
AA Change: K11N

DomainStartEndE-ValueType
Pfam:PfkB 41 359 1.1e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126536
SMART Domains Protein: ENSMUSP00000116046
Gene: ENSMUSG00000021824

DomainStartEndE-ValueType
SCOP:d1gw5m2 1 91 9e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130291
SMART Domains Protein: ENSMUSP00000118259
Gene: ENSMUSG00000021824

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 138 9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130370
SMART Domains Protein: ENSMUSP00000115157
Gene: ENSMUSG00000021824

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 138 1.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154460
SMART Domains Protein: ENSMUSP00000117346
Gene: ENSMUSG00000021824

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 136 1.8e-8 PFAM
Pfam:Adap_comp_sub 165 418 1e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223915
AA Change: K9N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000224016
Predicted Effect probably benign
Transcript: ENSMUST00000224899
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene an enzyme which catalyzes the transfer of the gamma-phosphate from ATP to adenosine, thereby serving as a regulator of concentrations of both extracellular adenosine and intracellular adenine nucleotides. Adenosine has widespread effects on the cardiovascular, nervous, respiratory, and immune systems and inhibitors of the enzyme could play an important pharmacological role in increasing intravascular adenosine concentrations and acting as anti-inflammatory agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this gene results in death before 14 days of age, growth retardation, liver abnormalities, apnea, and impaired temperature regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A T 6: 88,839,452 V120E probably benign Het
Acot11 G A 4: 106,758,402 T284M probably damaging Het
Akr1c14 T A 13: 4,088,966 N316K probably benign Het
AL732309.1 A T 2: 25,245,839 V121D probably benign Het
Amh C A 10: 80,806,653 Q257K probably benign Het
Antxrl T G 14: 34,065,849 H276Q probably benign Het
Atp5o G A 16: 91,926,867 T105M probably damaging Het
Atp5s T C 12: 69,741,669 I114T probably damaging Het
Atxn2 T G 5: 121,785,817 N734K possibly damaging Het
B3gat3 T A 19: 8,925,738 V153D probably benign Het
Brd2 A G 17: 34,113,822 V528A probably damaging Het
Camk2g T C 14: 20,747,839 S335G probably benign Het
Cbln2 T A 18: 86,716,734 W211R probably damaging Het
Cry2 A T 2: 92,412,981 I505N possibly damaging Het
Ddx55 T A 5: 124,560,721 C249S possibly damaging Het
Dglucy A G 12: 100,842,738 T232A probably damaging Het
Dhx32 A G 7: 133,759,477 Y76H probably benign Het
Dock7 T A 4: 98,973,412 N1356I unknown Het
Dock8 T A 19: 25,127,085 N710K probably benign Het
Dync1i2 T A 2: 71,249,356 N391K possibly damaging Het
Ect2 A G 3: 27,138,535 S420P probably damaging Het
Efcab5 T A 11: 77,137,779 E242V probably damaging Het
Fam83g T A 11: 61,684,753 Y74N probably damaging Het
Fbxo34 T A 14: 47,500,872 probably null Het
Flt4 A G 11: 49,626,009 T208A probably benign Het
Fxyd5 T A 7: 31,035,151 H183L unknown Het
Gpr150 T G 13: 76,056,466 D120A probably benign Het
Grm7 A G 6: 110,646,118 Y84C probably damaging Het
Ighmbp2 A G 19: 3,266,405 S562P probably damaging Het
Itga7 A G 10: 128,944,413 Y530C possibly damaging Het
Itpr3 T A 17: 27,118,561 D2448E probably benign Het
Mmp17 C A 5: 129,595,633 H216Q probably benign Het
Mns1 C T 9: 72,452,815 R416W probably damaging Het
Mog A G 17: 37,023,127 S25P unknown Het
Myh2 A G 11: 67,181,150 K568R possibly damaging Het
Myh7 A T 14: 54,972,490 probably null Het
Mymk A T 2: 27,067,368 W79R probably damaging Het
Ncoa4 T G 14: 32,177,369 L623R probably damaging Het
Oca2 G A 7: 56,279,538 probably benign Het
Odam A C 5: 87,887,545 S123R probably benign Het
Olfr1155 A G 2: 87,943,571 F19S probably damaging Het
Olfr263 A G 13: 21,133,257 T161A probably benign Het
Olfr292 T A 7: 86,694,804 M116K probably damaging Het
Olfr583 T C 7: 103,051,630 F111L probably benign Het
Olfr765 C T 10: 129,046,455 V203M probably benign Het
Olfr816 T A 10: 129,912,287 probably benign Het
Ovch2 C T 7: 107,794,433 C162Y probably damaging Het
Padi1 C A 4: 140,829,471 G142C probably damaging Het
Pcdhga4 A G 18: 37,687,398 I667V probably damaging Het
Pfas A T 11: 68,992,959 V624E probably damaging Het
Phb A T 11: 95,678,091 E184V probably damaging Het
Phlpp2 G T 8: 109,940,188 M1116I probably benign Het
Pip5kl1 T C 2: 32,580,431 probably null Het
Pitpnm2 T A 5: 124,125,356 I824F possibly damaging Het
Pla2g4c G A 7: 13,325,744 S2N possibly damaging Het
Pla2r1 A T 2: 60,427,625 probably null Het
Pole2 T C 12: 69,202,910 D521G probably damaging Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rapgef2 A T 3: 79,082,627 L931Q probably damaging Het
Rassf3 G A 10: 121,413,019 Q206* probably null Het
Rnf123 T A 9: 108,069,029 T316S probably damaging Het
Rnf138 T A 18: 21,008,693 probably null Het
Sept3 G A 15: 82,289,213 A249T probably damaging Het
Slc35a4 A T 18: 36,679,616 D3V unknown Het
Sltm T A 9: 70,543,965 probably null Het
Smarca2 C T 19: 26,654,464 Q560* probably null Het
Tcl1b1 A T 12: 105,164,531 D91V probably damaging Het
Tirap A T 9: 35,189,034 V118E probably damaging Het
Tlr5 T A 1: 182,974,233 Y367* probably null Het
Tmcc1 A G 6: 116,107,338 F5L probably benign Het
Tnxb A G 17: 34,716,501 M2592V probably benign Het
Trim66 T A 7: 109,460,244 E931V probably damaging Het
Ttn A G 2: 76,741,094 I26485T probably damaging Het
Veph1 C A 3: 66,158,282 V455L probably benign Het
Vmn1r125 A T 7: 21,272,825 H216L probably damaging Het
Wdr17 T A 8: 54,632,487 E1200D probably benign Het
Zbtb37 T A 1: 161,032,661 N25Y probably damaging Het
Other mutations in Adk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Adk APN 14 21092393 missense probably damaging 1.00
IGL01403:Adk APN 14 21234915 missense probably damaging 0.99
IGL01701:Adk APN 14 21103854 missense probably damaging 1.00
IGL02405:Adk APN 14 21103831 missense probably benign 0.06
IGL02808:Adk APN 14 21103833 missense probably benign 0.08
jeopardy UTSW 14 21234914 missense probably damaging 0.99
presumption UTSW 14 21240531 missense probably damaging 1.00
R0385:Adk UTSW 14 21318074 missense probably benign 0.01
R0463:Adk UTSW 14 21423536 missense probably benign 0.35
R0904:Adk UTSW 14 21092428 missense probably damaging 0.96
R1448:Adk UTSW 14 21052640 start codon destroyed probably null 0.00
R1695:Adk UTSW 14 21381600 missense probably benign 0.01
R2048:Adk UTSW 14 21318176 missense probably damaging 1.00
R4838:Adk UTSW 14 21369086 missense probably damaging 1.00
R5183:Adk UTSW 14 21240531 missense probably damaging 1.00
R5988:Adk UTSW 14 21423548 missense probably benign 0.03
R6770:Adk UTSW 14 21234914 missense probably damaging 0.99
R6932:Adk UTSW 14 21076308 start codon destroyed probably null 0.23
R7146:Adk UTSW 14 21326614 missense
R7491:Adk UTSW 14 21234929 missense probably damaging 0.96
R7806:Adk UTSW 14 21326611 missense
R7922:Adk UTSW 14 21318043 missense probably benign
R8465:Adk UTSW 14 21103824 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TAGAGCCAATGGTTATGGACTAG -3'
(R):5'- ACCTGAGCAGAGTCCAGAAC -3'

Sequencing Primer
(F):5'- CCAATGGTTATGGACTAGAGTCAC -3'
(R):5'- CACTGAGGGGAACAGCAGCTAC -3'
Posted On 2019-06-26