Incidental Mutation 'R7257:Ncoa4'
ID 564367
Institutional Source Beutler Lab
Gene Symbol Ncoa4
Ensembl Gene ENSMUSG00000056234
Gene Name nuclear receptor coactivator 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R7257 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 32159865-32179855 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 32177369 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 623 (L623R)
Ref Sequence ENSEMBL: ENSMUSP00000107625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013845] [ENSMUST00000111994] [ENSMUST00000163336] [ENSMUST00000163379] [ENSMUST00000164341] [ENSMUST00000168034] [ENSMUST00000168114] [ENSMUST00000168334] [ENSMUST00000168385] [ENSMUST00000169722] [ENSMUST00000170331] [ENSMUST00000226479] [ENSMUST00000226683]
AlphaFold Q5U4H9
Predicted Effect probably benign
Transcript: ENSMUST00000013845
SMART Domains Protein: ENSMUSP00000013845
Gene: ENSMUSG00000013701

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
Pfam:Tim17 76 196 6.6e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111994
AA Change: L623R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107625
Gene: ENSMUSG00000056234
AA Change: L623R

DomainStartEndE-ValueType
Pfam:ARA70 37 168 5e-44 PFAM
Pfam:ARA70 197 338 5.1e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163336
AA Change: L623R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126071
Gene: ENSMUSG00000056234
AA Change: L623R

DomainStartEndE-ValueType
Pfam:ARA70 33 169 2.4e-28 PFAM
Pfam:ARA70 199 334 4.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163379
SMART Domains Protein: ENSMUSP00000129688
Gene: ENSMUSG00000013701

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164341
SMART Domains Protein: ENSMUSP00000126780
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 37 99 3.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168034
SMART Domains Protein: ENSMUSP00000129422
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 45 131 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168114
SMART Domains Protein: ENSMUSP00000131253
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 64 105 2.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168334
SMART Domains Protein: ENSMUSP00000128739
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 37 96 1.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168385
SMART Domains Protein: ENSMUSP00000126222
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 1 73 8.2e-24 PFAM
Pfam:ARA70 102 205 2.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169722
SMART Domains Protein: ENSMUSP00000129917
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 37 168 6.5e-45 PFAM
Pfam:ARA70 196 337 6.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170331
SMART Domains Protein: ENSMUSP00000126977
Gene: ENSMUSG00000013701

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226479
Predicted Effect probably benign
Transcript: ENSMUST00000226683
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an androgen receptor coactivator. The encoded protein interacts with the androgen receptor in a ligand-dependent manner to enhance its transcriptional activity. Chromosomal translocations between this gene and the ret tyrosine kinase gene, also located on chromosome 10, have been associated with papillary thyroid carcinoma. Alternatively spliced transcript variants have been described. Pseudogenes are present on chromosomes 4, 5, 10, and 14. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mouse embryonic fibroblasts isolated from homozygous null mice exhibit abnormal DNA replication, decreased fibroblast proliferation, and early cellular replicative senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A T 6: 88,839,452 V120E probably benign Het
Acot11 G A 4: 106,758,402 T284M probably damaging Het
Adk G T 14: 21,052,671 K11N probably damaging Het
Akr1c14 T A 13: 4,088,966 N316K probably benign Het
AL732309.1 A T 2: 25,245,839 V121D probably benign Het
Amh C A 10: 80,806,653 Q257K probably benign Het
Antxrl T G 14: 34,065,849 H276Q probably benign Het
Atp5o G A 16: 91,926,867 T105M probably damaging Het
Atp5s T C 12: 69,741,669 I114T probably damaging Het
Atxn2 T G 5: 121,785,817 N734K possibly damaging Het
B3gat3 T A 19: 8,925,738 V153D probably benign Het
Brd2 A G 17: 34,113,822 V528A probably damaging Het
Camk2g T C 14: 20,747,839 S335G probably benign Het
Cbln2 T A 18: 86,716,734 W211R probably damaging Het
Cry2 A T 2: 92,412,981 I505N possibly damaging Het
Ddx55 T A 5: 124,560,721 C249S possibly damaging Het
Dglucy A G 12: 100,842,738 T232A probably damaging Het
Dhx32 A G 7: 133,759,477 Y76H probably benign Het
Dock7 T A 4: 98,973,412 N1356I unknown Het
Dock8 T A 19: 25,127,085 N710K probably benign Het
Dync1i2 T A 2: 71,249,356 N391K possibly damaging Het
Ect2 A G 3: 27,138,535 S420P probably damaging Het
Efcab5 T A 11: 77,137,779 E242V probably damaging Het
Fam83g T A 11: 61,684,753 Y74N probably damaging Het
Fbxo34 T A 14: 47,500,872 probably null Het
Flt4 A G 11: 49,626,009 T208A probably benign Het
Fxyd5 T A 7: 31,035,151 H183L unknown Het
Gpr150 T G 13: 76,056,466 D120A probably benign Het
Grm7 A G 6: 110,646,118 Y84C probably damaging Het
Ighmbp2 A G 19: 3,266,405 S562P probably damaging Het
Itga7 A G 10: 128,944,413 Y530C possibly damaging Het
Itpr3 T A 17: 27,118,561 D2448E probably benign Het
Mmp17 C A 5: 129,595,633 H216Q probably benign Het
Mns1 C T 9: 72,452,815 R416W probably damaging Het
Mog A G 17: 37,023,127 S25P unknown Het
Myh2 A G 11: 67,181,150 K568R possibly damaging Het
Myh7 A T 14: 54,972,490 probably null Het
Mymk A T 2: 27,067,368 W79R probably damaging Het
Oca2 G A 7: 56,279,538 probably benign Het
Odam A C 5: 87,887,545 S123R probably benign Het
Olfr1155 A G 2: 87,943,571 F19S probably damaging Het
Olfr263 A G 13: 21,133,257 T161A probably benign Het
Olfr292 T A 7: 86,694,804 M116K probably damaging Het
Olfr583 T C 7: 103,051,630 F111L probably benign Het
Olfr765 C T 10: 129,046,455 V203M probably benign Het
Olfr816 T A 10: 129,912,287 probably benign Het
Ovch2 C T 7: 107,794,433 C162Y probably damaging Het
Padi1 C A 4: 140,829,471 G142C probably damaging Het
Pcdhga4 A G 18: 37,687,398 I667V probably damaging Het
Pfas A T 11: 68,992,959 V624E probably damaging Het
Phb A T 11: 95,678,091 E184V probably damaging Het
Phlpp2 G T 8: 109,940,188 M1116I probably benign Het
Pip5kl1 T C 2: 32,580,431 probably null Het
Pitpnm2 T A 5: 124,125,356 I824F possibly damaging Het
Pla2g4c G A 7: 13,325,744 S2N possibly damaging Het
Pla2r1 A T 2: 60,427,625 probably null Het
Pole2 T C 12: 69,202,910 D521G probably damaging Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rapgef2 A T 3: 79,082,627 L931Q probably damaging Het
Rassf3 G A 10: 121,413,019 Q206* probably null Het
Rnf123 T A 9: 108,069,029 T316S probably damaging Het
Rnf138 T A 18: 21,008,693 probably null Het
Sept3 G A 15: 82,289,213 A249T probably damaging Het
Slc35a4 A T 18: 36,679,616 D3V unknown Het
Sltm T A 9: 70,543,965 probably null Het
Smarca2 C T 19: 26,654,464 Q560* probably null Het
Tcl1b1 A T 12: 105,164,531 D91V probably damaging Het
Tirap A T 9: 35,189,034 V118E probably damaging Het
Tlr5 T A 1: 182,974,233 Y367* probably null Het
Tmcc1 A G 6: 116,107,338 F5L probably benign Het
Tnxb A G 17: 34,716,501 M2592V probably benign Het
Trim66 T A 7: 109,460,244 E931V probably damaging Het
Ttn A G 2: 76,741,094 I26485T probably damaging Het
Veph1 C A 3: 66,158,282 V455L probably benign Het
Vmn1r125 A T 7: 21,272,825 H216L probably damaging Het
Wdr17 T A 8: 54,632,487 E1200D probably benign Het
Zbtb37 T A 1: 161,032,661 N25Y probably damaging Het
Other mutations in Ncoa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Ncoa4 APN 14 32172927 missense probably benign 0.19
IGL02963:Ncoa4 APN 14 32176509 missense probably damaging 1.00
IGL03062:Ncoa4 APN 14 32173420 missense possibly damaging 0.89
R0613:Ncoa4 UTSW 14 32176552 missense probably damaging 1.00
R1353:Ncoa4 UTSW 14 32170858 nonsense probably null
R1395:Ncoa4 UTSW 14 32172841 splice site probably null
R1430:Ncoa4 UTSW 14 32176722 missense probably benign 0.00
R1509:Ncoa4 UTSW 14 32173434 missense probably damaging 1.00
R1541:Ncoa4 UTSW 14 32176888 missense probably damaging 1.00
R2292:Ncoa4 UTSW 14 32173456 missense probably damaging 0.98
R4610:Ncoa4 UTSW 14 32176725 missense probably benign 0.01
R4713:Ncoa4 UTSW 14 32176641 missense probably benign 0.05
R5750:Ncoa4 UTSW 14 32177307 nonsense probably null
R5889:Ncoa4 UTSW 14 32166659 unclassified probably benign
R5928:Ncoa4 UTSW 14 32166721 critical splice donor site probably null
R6738:Ncoa4 UTSW 14 32170793 missense probably benign
R7065:Ncoa4 UTSW 14 32172900 nonsense probably null
R7165:Ncoa4 UTSW 14 32175983 missense probably damaging 0.97
R8373:Ncoa4 UTSW 14 32176936 missense probably damaging 1.00
R8919:Ncoa4 UTSW 14 32172891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCCATGCTTACCAGTAGTCATC -3'
(R):5'- GCTACCCACAATCCATGAGG -3'

Sequencing Primer
(F):5'- CCAGCAGTTTGTGATCTC -3'
(R):5'- ACTGAACTCAGATTGTCAGGC -3'
Posted On 2019-06-26