Incidental Mutation 'R7257:Cbln2'
ID 564379
Institutional Source Beutler Lab
Gene Symbol Cbln2
Ensembl Gene ENSMUSG00000024647
Gene Name cerebellin 2 precursor protein
Synonyms 6330593N19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock # R7257 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 86711110-86718283 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86716734 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 211 (W211R)
Ref Sequence ENSEMBL: ENSMUSP00000068863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068423] [ENSMUST00000122079] [ENSMUST00000122464] [ENSMUST00000169470]
AlphaFold Q8BGU2
Predicted Effect probably damaging
Transcript: ENSMUST00000068423
AA Change: W211R

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068863
Gene: ENSMUSG00000024647
AA Change: W211R

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
C1Q 86 224 4.65e-61 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122079
AA Change: W211R

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113695
Gene: ENSMUSG00000024647
AA Change: W211R

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
C1Q 86 224 4.65e-61 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122464
AA Change: W211R

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113996
Gene: ENSMUSG00000024647
AA Change: W211R

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
C1Q 86 224 4.65e-61 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169470
AA Change: W211R

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126810
Gene: ENSMUSG00000024647
AA Change: W211R

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
C1Q 86 224 4.65e-61 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to a family of secreted neuronal glycoproteins. The transcript is broadly expressed in the embryonic and adult brain with higher levels in some regions including the olfactory bulb, thalamus, and cerebral cortex. The protein can bind to presynaptic neurexins and induce synaptogenesis in cultured neurons. Null mutant mice are viable, fertile and do not display obvious neuroanatomical defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: No overt anatomical or neuroanatomical defects are observed in mice homozygous for deletion of this gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A T 6: 88,839,452 V120E probably benign Het
Acot11 G A 4: 106,758,402 T284M probably damaging Het
Adk G T 14: 21,052,671 K11N probably damaging Het
Akr1c14 T A 13: 4,088,966 N316K probably benign Het
AL732309.1 A T 2: 25,245,839 V121D probably benign Het
Amh C A 10: 80,806,653 Q257K probably benign Het
Antxrl T G 14: 34,065,849 H276Q probably benign Het
Atp5o G A 16: 91,926,867 T105M probably damaging Het
Atp5s T C 12: 69,741,669 I114T probably damaging Het
Atxn2 T G 5: 121,785,817 N734K possibly damaging Het
B3gat3 T A 19: 8,925,738 V153D probably benign Het
Brd2 A G 17: 34,113,822 V528A probably damaging Het
Camk2g T C 14: 20,747,839 S335G probably benign Het
Cry2 A T 2: 92,412,981 I505N possibly damaging Het
Ddx55 T A 5: 124,560,721 C249S possibly damaging Het
Dglucy A G 12: 100,842,738 T232A probably damaging Het
Dhx32 A G 7: 133,759,477 Y76H probably benign Het
Dock7 T A 4: 98,973,412 N1356I unknown Het
Dock8 T A 19: 25,127,085 N710K probably benign Het
Dync1i2 T A 2: 71,249,356 N391K possibly damaging Het
Ect2 A G 3: 27,138,535 S420P probably damaging Het
Efcab5 T A 11: 77,137,779 E242V probably damaging Het
Fam83g T A 11: 61,684,753 Y74N probably damaging Het
Fbxo34 T A 14: 47,500,872 probably null Het
Flt4 A G 11: 49,626,009 T208A probably benign Het
Fxyd5 T A 7: 31,035,151 H183L unknown Het
Gpr150 T G 13: 76,056,466 D120A probably benign Het
Grm7 A G 6: 110,646,118 Y84C probably damaging Het
Ighmbp2 A G 19: 3,266,405 S562P probably damaging Het
Itga7 A G 10: 128,944,413 Y530C possibly damaging Het
Itpr3 T A 17: 27,118,561 D2448E probably benign Het
Mmp17 C A 5: 129,595,633 H216Q probably benign Het
Mns1 C T 9: 72,452,815 R416W probably damaging Het
Mog A G 17: 37,023,127 S25P unknown Het
Myh2 A G 11: 67,181,150 K568R possibly damaging Het
Myh7 A T 14: 54,972,490 probably null Het
Mymk A T 2: 27,067,368 W79R probably damaging Het
Ncoa4 T G 14: 32,177,369 L623R probably damaging Het
Oca2 G A 7: 56,279,538 probably benign Het
Odam A C 5: 87,887,545 S123R probably benign Het
Olfr1155 A G 2: 87,943,571 F19S probably damaging Het
Olfr263 A G 13: 21,133,257 T161A probably benign Het
Olfr292 T A 7: 86,694,804 M116K probably damaging Het
Olfr583 T C 7: 103,051,630 F111L probably benign Het
Olfr765 C T 10: 129,046,455 V203M probably benign Het
Olfr816 T A 10: 129,912,287 probably benign Het
Ovch2 C T 7: 107,794,433 C162Y probably damaging Het
Padi1 C A 4: 140,829,471 G142C probably damaging Het
Pcdhga4 A G 18: 37,687,398 I667V probably damaging Het
Pfas A T 11: 68,992,959 V624E probably damaging Het
Phb A T 11: 95,678,091 E184V probably damaging Het
Phlpp2 G T 8: 109,940,188 M1116I probably benign Het
Pip5kl1 T C 2: 32,580,431 probably null Het
Pitpnm2 T A 5: 124,125,356 I824F possibly damaging Het
Pla2g4c G A 7: 13,325,744 S2N possibly damaging Het
Pla2r1 A T 2: 60,427,625 probably null Het
Pole2 T C 12: 69,202,910 D521G probably damaging Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rapgef2 A T 3: 79,082,627 L931Q probably damaging Het
Rassf3 G A 10: 121,413,019 Q206* probably null Het
Rnf123 T A 9: 108,069,029 T316S probably damaging Het
Rnf138 T A 18: 21,008,693 probably null Het
Sept3 G A 15: 82,289,213 A249T probably damaging Het
Slc35a4 A T 18: 36,679,616 D3V unknown Het
Sltm T A 9: 70,543,965 probably null Het
Smarca2 C T 19: 26,654,464 Q560* probably null Het
Tcl1b1 A T 12: 105,164,531 D91V probably damaging Het
Tirap A T 9: 35,189,034 V118E probably damaging Het
Tlr5 T A 1: 182,974,233 Y367* probably null Het
Tmcc1 A G 6: 116,107,338 F5L probably benign Het
Tnxb A G 17: 34,716,501 M2592V probably benign Het
Trim66 T A 7: 109,460,244 E931V probably damaging Het
Ttn A G 2: 76,741,094 I26485T probably damaging Het
Veph1 C A 3: 66,158,282 V455L probably benign Het
Vmn1r125 A T 7: 21,272,825 H216L probably damaging Het
Wdr17 T A 8: 54,632,487 E1200D probably benign Het
Zbtb37 T A 1: 161,032,661 N25Y probably damaging Het
Other mutations in Cbln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Cbln2 APN 18 86716384 nonsense probably null
IGL01942:Cbln2 APN 18 86716325 missense probably benign 0.44
IGL02369:Cbln2 APN 18 86713354 missense probably damaging 1.00
IGL02983:Cbln2 APN 18 86713379 missense probably benign 0.07
R0899:Cbln2 UTSW 18 86716752 missense possibly damaging 0.91
R1778:Cbln2 UTSW 18 86713147 missense probably benign 0.11
R2004:Cbln2 UTSW 18 86716666 missense probably damaging 0.99
R5571:Cbln2 UTSW 18 86713148 missense probably benign
R7136:Cbln2 UTSW 18 86716672 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTCTTCTGCCTTATAGGTCAGC -3'
(R):5'- GGTTCCCGAGGAATTGTCAATAG -3'

Sequencing Primer
(F):5'- GTCAGCTTAATGCAGAATGGCTACC -3'
(R):5'- TCCCGAGGAATTGTCAATAGTCAAAG -3'
Posted On 2019-06-26