Incidental Mutation 'R7257:B3gat3'
ID564381
Institutional Source Beutler Lab
Gene Symbol B3gat3
Ensembl Gene ENSMUSG00000071649
Gene Namebeta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
Synonyms2810405M13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7257 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8920374-8927234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8925738 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 153 (V153D)
Ref Sequence ENSEMBL: ENSMUSP00000093962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096241] [ENSMUST00000096242] [ENSMUST00000096243] [ENSMUST00000224272]
Predicted Effect probably benign
Transcript: ENSMUST00000096241
SMART Domains Protein: ENSMUSP00000093960
Gene: ENSMUSG00000071647

DomainStartEndE-ValueType
coiled coil region 12 47 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 118 139 N/A INTRINSIC
low complexity region 149 168 N/A INTRINSIC
low complexity region 198 208 N/A INTRINSIC
Pfam:HELP 215 286 5.3e-30 PFAM
WD40 295 344 6.34e-2 SMART
Blast:WD40 347 392 5e-22 BLAST
WD40 395 434 1.56e-1 SMART
WD40 450 487 2.64e2 SMART
WD40 504 543 3.33e-1 SMART
WD40 587 626 2.69e-5 SMART
WD40 670 709 1.7e-2 SMART
WD40 716 755 1.52e-4 SMART
WD40 829 869 1.29e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096242
SMART Domains Protein: ENSMUSP00000093961
Gene: ENSMUSG00000071648

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Tetraspannin 17 291 1e-18 PFAM
low complexity region 331 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096243
AA Change: V153D

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000093962
Gene: ENSMUSG00000071649
AA Change: V153D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 58 75 N/A INTRINSIC
Pfam:Glyco_transf_43 96 312 1.8e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224272
Meta Mutation Damage Score 0.0744 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the glucuronyltransferase gene family, enzymes that exhibit strict acceptor specificity, recognizing nonreducing terminal sugars and their anomeric linkages. This gene product catalyzes the formation of the glycosaminoglycan-protein linkage by way of a glucuronyl transfer reaction in the final step of the biosynthesis of the linkage region of proteoglycans. A pseudogene of this gene has been identified on chromosome 3. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous mutants die prenatally before the 8-cell stage due to failed cytokinesis, and show reduction of the synthesis of chondroitin sulfate and heparan sulfate glycosaminoglycans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A T 6: 88,839,452 V120E probably benign Het
Acot11 G A 4: 106,758,402 T284M probably damaging Het
Adk G T 14: 21,052,671 K11N probably damaging Het
Akr1c14 T A 13: 4,088,966 N316K probably benign Het
AL732309.1 A T 2: 25,245,839 V121D probably benign Het
Amh C A 10: 80,806,653 Q257K probably benign Het
Antxrl T G 14: 34,065,849 H276Q probably benign Het
Atp5o G A 16: 91,926,867 T105M probably damaging Het
Atp5s T C 12: 69,741,669 I114T probably damaging Het
Atxn2 T G 5: 121,785,817 N734K possibly damaging Het
Brd2 A G 17: 34,113,822 V528A probably damaging Het
Camk2g T C 14: 20,747,839 S335G probably benign Het
Cbln2 T A 18: 86,716,734 W211R probably damaging Het
Cry2 A T 2: 92,412,981 I505N possibly damaging Het
Ddx55 T A 5: 124,560,721 C249S possibly damaging Het
Dglucy A G 12: 100,842,738 T232A probably damaging Het
Dhx32 A G 7: 133,759,477 Y76H probably benign Het
Dock7 T A 4: 98,973,412 N1356I unknown Het
Dock8 T A 19: 25,127,085 N710K probably benign Het
Dync1i2 T A 2: 71,249,356 N391K possibly damaging Het
Ect2 A G 3: 27,138,535 S420P probably damaging Het
Efcab5 T A 11: 77,137,779 E242V probably damaging Het
Fam83g T A 11: 61,684,753 Y74N probably damaging Het
Fbxo34 T A 14: 47,500,872 probably null Het
Flt4 A G 11: 49,626,009 T208A probably benign Het
Fxyd5 T A 7: 31,035,151 H183L unknown Het
Gpr150 T G 13: 76,056,466 D120A probably benign Het
Grm7 A G 6: 110,646,118 Y84C probably damaging Het
Ighmbp2 A G 19: 3,266,405 S562P probably damaging Het
Itga7 A G 10: 128,944,413 Y530C possibly damaging Het
Itpr3 T A 17: 27,118,561 D2448E probably benign Het
Mmp17 C A 5: 129,595,633 H216Q probably benign Het
Mns1 C T 9: 72,452,815 R416W probably damaging Het
Mog A G 17: 37,023,127 S25P unknown Het
Myh2 A G 11: 67,181,150 K568R possibly damaging Het
Myh7 A T 14: 54,972,490 probably null Het
Mymk A T 2: 27,067,368 W79R probably damaging Het
Ncoa4 T G 14: 32,177,369 L623R probably damaging Het
Oca2 G A 7: 56,279,538 probably benign Het
Odam A C 5: 87,887,545 S123R probably benign Het
Olfr1155 A G 2: 87,943,571 F19S probably damaging Het
Olfr263 A G 13: 21,133,257 T161A probably benign Het
Olfr292 T A 7: 86,694,804 M116K probably damaging Het
Olfr583 T C 7: 103,051,630 F111L probably benign Het
Olfr765 C T 10: 129,046,455 V203M probably benign Het
Olfr816 T A 10: 129,912,287 probably benign Het
Ovch2 C T 7: 107,794,433 C162Y probably damaging Het
Padi1 C A 4: 140,829,471 G142C probably damaging Het
Pcdhga4 A G 18: 37,687,398 I667V probably damaging Het
Pfas A T 11: 68,992,959 V624E probably damaging Het
Phb A T 11: 95,678,091 E184V probably damaging Het
Phlpp2 G T 8: 109,940,188 M1116I probably benign Het
Pip5kl1 T C 2: 32,580,431 probably null Het
Pitpnm2 T A 5: 124,125,356 I824F possibly damaging Het
Pla2g4c G A 7: 13,325,744 S2N possibly damaging Het
Pla2r1 A T 2: 60,427,625 probably null Het
Pole2 T C 12: 69,202,910 D521G probably damaging Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rapgef2 A T 3: 79,082,627 L931Q probably damaging Het
Rassf3 G A 10: 121,413,019 Q206* probably null Het
Rnf123 T A 9: 108,069,029 T316S probably damaging Het
Rnf138 T A 18: 21,008,693 probably null Het
Sept3 G A 15: 82,289,213 A249T probably damaging Het
Slc35a4 A T 18: 36,679,616 D3V unknown Het
Sltm T A 9: 70,543,965 probably null Het
Smarca2 C T 19: 26,654,464 Q560* probably null Het
Tcl1b1 A T 12: 105,164,531 D91V probably damaging Het
Tirap A T 9: 35,189,034 V118E probably damaging Het
Tlr5 T A 1: 182,974,233 Y367* probably null Het
Tmcc1 A G 6: 116,107,338 F5L probably benign Het
Tnxb A G 17: 34,716,501 M2592V probably benign Het
Trim66 T A 7: 109,460,244 E931V probably damaging Het
Ttn A G 2: 76,741,094 I26485T probably damaging Het
Veph1 C A 3: 66,158,282 V455L probably benign Het
Vmn1r125 A T 7: 21,272,825 H216L probably damaging Het
Wdr17 T A 8: 54,632,487 E1200D probably benign Het
Zbtb37 T A 1: 161,032,661 N25Y probably damaging Het
Other mutations in B3gat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:B3gat3 APN 19 8926785 missense probably benign 0.44
IGL03244:B3gat3 APN 19 8925851 missense probably damaging 1.00
Bounce UTSW 19 8925632 missense possibly damaging 0.90
resilient UTSW 19 8925738 missense probably benign 0.16
spongy UTSW 19 8925852 missense probably damaging 1.00
R4658:B3gat3 UTSW 19 8925632 missense possibly damaging 0.90
R7140:B3gat3 UTSW 19 8925852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAGGGCCAAGGTTACCTG -3'
(R):5'- GGCTCACCTCCTTAAAGAGC -3'

Sequencing Primer
(F):5'- CCTCTGCAGGCTGGTACAAAAG -3'
(R):5'- TCCTTAAAGAGCTCCCGGC -3'
Posted On2019-06-26