Incidental Mutation 'R7258:Nms'
ID 564385
Institutional Source Beutler Lab
Gene Symbol Nms
Ensembl Gene ENSMUSG00000067604
Gene Name neuromedin S
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R7258 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 38939149-38950276 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 38946970 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 121 (T121A)
Ref Sequence ENSEMBL: ENSMUSP00000085346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088029] [ENSMUST00000160214]
AlphaFold Q5H8A1
Predicted Effect probably benign
Transcript: ENSMUST00000088029
AA Change: T121A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000085346
Gene: ENSMUSG00000067604
AA Change: T121A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160214
AA Change: T113A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125166
Gene: ENSMUSG00000067604
AA Change: T113A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: This gene encodes a member of the neuromedin family of neuropeptides. The encoded protein is a precursor that is proteolytically processed to generate a biologically active neuropeptide that plays a role in the regulation of circadian rhythm, anorexigenic action, antidiuretic action, cardiovascular function and stimulation of oxytocin and vasopressin release. Mice lacking the encoded neuropeptide exhibit decreased heart rate without any accompanying changes in blood pressure. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature peptide. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik A C 1: 87,475,067 I40L probably benign Het
4933402J07Rik A C 8: 87,586,177 S197R probably damaging Het
Abcc12 T C 8: 86,560,857 R120G possibly damaging Het
Abhd14b A G 9: 106,450,219 I67V probably benign Het
Alpk1 A T 3: 127,724,466 V62E probably damaging Het
Ankar A G 1: 72,651,727 V1196A probably benign Het
B230118H07Rik T C 2: 101,610,592 D22G probably null Het
Ccr5 A T 9: 124,125,274 K305* probably null Het
Cdc42bpb T C 12: 111,326,084 H339R probably damaging Het
Cep290 T G 10: 100,499,108 M330R probably benign Het
Cyfip2 T C 11: 46,224,177 Y901C probably benign Het
Ddx54 T G 5: 120,620,747 Y352D probably damaging Het
Defa35 A T 8: 21,065,229 H55L possibly damaging Het
Dnmt3b T A 2: 153,683,599 probably null Het
Enpep A C 3: 129,332,075 L136R probably benign Het
Epb41l2 G A 10: 25,484,287 A516T probably damaging Het
Frmd4a A T 2: 4,300,953 Q13L probably benign Het
Frmpd1 C A 4: 45,269,974 D271E possibly damaging Het
Gbp5 T A 3: 142,506,781 L410H probably damaging Het
Gipc2 T C 3: 152,165,715 E58G probably damaging Het
Gm281 A T 14: 13,899,648 F91L Het
Gm6309 A T 5: 146,168,296 V269E probably benign Het
Grm5 A T 7: 88,074,706 T735S probably damaging Het
H6pd T C 4: 149,996,362 M9V probably benign Het
Hmcn1 A G 1: 150,715,823 I1875T probably benign Het
Hrc T A 7: 45,336,296 D290E possibly damaging Het
Ippk C A 13: 49,433,862 Q136K probably benign Het
Kcnv1 T C 15: 45,109,315 T391A probably damaging Het
Kdm5b A C 1: 134,621,021 E1088A probably damaging Het
L1td1 C T 4: 98,736,864 A432V probably benign Het
Ly86 A G 13: 37,345,497 D20G probably benign Het
Myo1g A G 11: 6,509,416 I818T possibly damaging Het
Olfr1084 T A 2: 86,639,001 K236* probably null Het
Olfr1414 A T 1: 92,511,176 I284N possibly damaging Het
Olfr350 T A 2: 36,850,340 I98K probably damaging Het
Olfr391-ps T G 11: 73,799,380 I126L probably damaging Het
Olfr609 G C 7: 103,492,589 C96W probably damaging Het
Olfr816 T A 10: 129,912,287 probably benign Het
Pcdhb9 T C 18: 37,402,114 L387P probably damaging Het
Pcsk1 G A 13: 75,093,186 R95H probably damaging Het
Pde11a T C 2: 76,139,906 D502G possibly damaging Het
Plekhg2 T C 7: 28,364,778 D446G probably benign Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rasal2 A T 1: 157,157,700 L826M probably damaging Het
Rnf213 A G 11: 119,452,575 I3589V Het
Sin3b T C 8: 72,750,208 C757R probably benign Het
Slc41a1 T A 1: 131,842,042 V300D probably benign Het
Snrpa1 T C 7: 66,070,143 F162L probably damaging Het
Sox30 C A 11: 45,980,552 A78E unknown Het
Ssc4d G T 5: 135,963,087 A401E probably damaging Het
Steap3 A G 1: 120,243,986 F130L possibly damaging Het
Stx5a A G 19: 8,754,907 probably null Het
Tgfbr2 A T 9: 116,129,830 I172N probably damaging Het
Tgm4 A G 9: 123,062,491 D557G probably benign Het
Tmprss11c A G 5: 86,271,413 S96P probably damaging Het
Trpa1 T G 1: 14,903,249 T282P probably damaging Het
Uba5 A T 9: 104,062,933 V5E unknown Het
Ugt2b36 A T 5: 87,080,903 L427H probably damaging Het
Utp14b T A 1: 78,664,974 H196Q probably benign Het
Vmn2r44 T A 7: 8,377,849 L348F probably damaging Het
Vmn2r93 T G 17: 18,305,141 L354V probably benign Het
Wwc2 T A 8: 47,842,999 N1079Y unknown Het
Zfp653 T C 9: 22,065,820 D145G probably benign Het
Zfp777 T C 6: 48,025,797 E453G probably damaging Het
Zfp936 T A 7: 43,190,379 H423Q probably damaging Het
Zfyve9 A T 4: 108,656,954 Y496N possibly damaging Het
Other mutations in Nms
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Nms APN 1 38946111 missense possibly damaging 0.92
IGL01959:Nms APN 1 38941925 splice site probably benign
IGL02088:Nms APN 1 38939277 utr 5 prime probably benign
IGL02810:Nms APN 1 38948644 missense possibly damaging 0.94
IGL03001:Nms APN 1 38941912 missense probably benign 0.12
alacrity UTSW 1 38941895 missense probably benign 0.04
R1087:Nms UTSW 1 38944111 critical splice donor site probably null
R3689:Nms UTSW 1 38946994 splice site probably benign
R4426:Nms UTSW 1 38939296 missense probably benign
R6910:Nms UTSW 1 38941895 missense probably benign 0.04
R8848:Nms UTSW 1 38939310 missense probably benign
R9108:Nms UTSW 1 38946066 missense possibly damaging 0.78
R9493:Nms UTSW 1 38941901 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGTTGAGTGAACAAGCTTCC -3'
(R):5'- TTTGTATCTCAGGATAAGCCCAAG -3'

Sequencing Primer
(F):5'- GAGTGAACAAGCTTCCCTTTCAG -3'
(R):5'- GAAATACCCAACTTCAATGCTTAGAG -3'
Posted On 2019-06-26