Incidental Mutation 'R7258:Nms'
ID 564385
Institutional Source Beutler Lab
Gene Symbol Nms
Ensembl Gene ENSMUSG00000067604
Gene Name neuromedin S
Synonyms
MMRRC Submission 045386-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R7258 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 38978230-38989357 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 38986051 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 121 (T121A)
Ref Sequence ENSEMBL: ENSMUSP00000085346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088029] [ENSMUST00000160214]
AlphaFold Q5H8A1
Predicted Effect probably benign
Transcript: ENSMUST00000088029
AA Change: T121A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000085346
Gene: ENSMUSG00000067604
AA Change: T121A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160214
AA Change: T113A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125166
Gene: ENSMUSG00000067604
AA Change: T113A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: This gene encodes a member of the neuromedin family of neuropeptides. The encoded protein is a precursor that is proteolytically processed to generate a biologically active neuropeptide that plays a role in the regulation of circadian rhythm, anorexigenic action, antidiuretic action, cardiovascular function and stimulation of oxytocin and vasopressin release. Mice lacking the encoded neuropeptide exhibit decreased heart rate without any accompanying changes in blood pressure. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature peptide. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik A C 8: 88,312,805 (GRCm39) S197R probably damaging Het
Abcc12 T C 8: 87,287,486 (GRCm39) R120G possibly damaging Het
Abhd14b A G 9: 106,327,418 (GRCm39) I67V probably benign Het
Alpk1 A T 3: 127,518,115 (GRCm39) V62E probably damaging Het
Ankar A G 1: 72,690,886 (GRCm39) V1196A probably benign Het
Ccr5 A T 9: 123,925,311 (GRCm39) K305* probably null Het
Cdc42bpb T C 12: 111,292,518 (GRCm39) H339R probably damaging Het
Cdhr18 A T 14: 13,899,648 (GRCm38) F91L Het
Cep290 T G 10: 100,334,970 (GRCm39) M330R probably benign Het
Cyfip2 T C 11: 46,115,004 (GRCm39) Y901C probably benign Het
Ddx54 T G 5: 120,758,812 (GRCm39) Y352D probably damaging Het
Defa35 A T 8: 21,555,245 (GRCm39) H55L possibly damaging Het
Dnmt3b T A 2: 153,525,519 (GRCm39) probably null Het
Enpep A C 3: 129,125,724 (GRCm39) L136R probably benign Het
Epb41l2 G A 10: 25,360,185 (GRCm39) A516T probably damaging Het
Frmd4a A T 2: 4,305,764 (GRCm39) Q13L probably benign Het
Frmpd1 C A 4: 45,269,974 (GRCm39) D271E possibly damaging Het
Gbp5 T A 3: 142,212,542 (GRCm39) L410H probably damaging Het
Gipc2 T C 3: 151,871,352 (GRCm39) E58G probably damaging Het
Gm6309 A T 5: 146,105,106 (GRCm39) V269E probably benign Het
Grm5 A T 7: 87,723,914 (GRCm39) T735S probably damaging Het
H6pd T C 4: 150,080,819 (GRCm39) M9V probably benign Het
Hmcn1 A G 1: 150,591,574 (GRCm39) I1875T probably benign Het
Hrc T A 7: 44,985,720 (GRCm39) D290E possibly damaging Het
Iftap T C 2: 101,440,937 (GRCm39) D22G probably null Het
Ippk C A 13: 49,587,338 (GRCm39) Q136K probably benign Het
Kcnv1 T C 15: 44,972,711 (GRCm39) T391A probably damaging Het
Kdm5b A C 1: 134,548,759 (GRCm39) E1088A probably damaging Het
L1td1 C T 4: 98,625,101 (GRCm39) A432V probably benign Het
Ly86 A G 13: 37,529,473 (GRCm39) D20G probably benign Het
Myo1g A G 11: 6,459,416 (GRCm39) I818T possibly damaging Het
Or1e31 T G 11: 73,690,206 (GRCm39) I126L probably damaging Het
Or1j4 T A 2: 36,740,352 (GRCm39) I98K probably damaging Het
Or51af1 G C 7: 103,141,796 (GRCm39) C96W probably damaging Het
Or6b3 A T 1: 92,438,898 (GRCm39) I284N possibly damaging Het
Or6c69 T A 10: 129,748,156 (GRCm39) probably benign Het
Or8k37 T A 2: 86,469,345 (GRCm39) K236* probably null Het
Pcdhb9 T C 18: 37,535,167 (GRCm39) L387P probably damaging Het
Pcsk1 G A 13: 75,241,305 (GRCm39) R95H probably damaging Het
Pde11a T C 2: 75,970,250 (GRCm39) D502G possibly damaging Het
Plekhg2 T C 7: 28,064,203 (GRCm39) D446G probably benign Het
Ptch1 T C 13: 63,721,108 (GRCm39) K54E not run Het
Rasal2 A T 1: 156,985,270 (GRCm39) L826M probably damaging Het
Rnf213 A G 11: 119,343,401 (GRCm39) I3589V Het
Sin3b T C 8: 73,476,836 (GRCm39) C757R probably benign Het
Slc41a1 T A 1: 131,769,780 (GRCm39) V300D probably benign Het
Snorc A C 1: 87,402,789 (GRCm39) I40L probably benign Het
Snrpa1 T C 7: 65,719,891 (GRCm39) F162L probably damaging Het
Sox30 C A 11: 45,871,379 (GRCm39) A78E unknown Het
Ssc4d G T 5: 135,991,941 (GRCm39) A401E probably damaging Het
Steap3 A G 1: 120,171,716 (GRCm39) F130L possibly damaging Het
Stx5a A G 19: 8,732,271 (GRCm39) probably null Het
Tgfbr2 A T 9: 115,958,898 (GRCm39) I172N probably damaging Het
Tgm4 A G 9: 122,891,556 (GRCm39) D557G probably benign Het
Tmprss11c A G 5: 86,419,272 (GRCm39) S96P probably damaging Het
Trpa1 T G 1: 14,973,473 (GRCm39) T282P probably damaging Het
Uba5 A T 9: 103,940,132 (GRCm39) V5E unknown Het
Ugt2b36 A T 5: 87,228,762 (GRCm39) L427H probably damaging Het
Utp14b T A 1: 78,642,691 (GRCm39) H196Q probably benign Het
Vmn2r44 T A 7: 8,380,848 (GRCm39) L348F probably damaging Het
Vmn2r93 T G 17: 18,525,403 (GRCm39) L354V probably benign Het
Wwc2 T A 8: 48,296,034 (GRCm39) N1079Y unknown Het
Zfp653 T C 9: 21,977,116 (GRCm39) D145G probably benign Het
Zfp777 T C 6: 48,002,731 (GRCm39) E453G probably damaging Het
Zfp936 T A 7: 42,839,803 (GRCm39) H423Q probably damaging Het
Zfyve9 A T 4: 108,514,151 (GRCm39) Y496N possibly damaging Het
Other mutations in Nms
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Nms APN 1 38,985,192 (GRCm39) missense possibly damaging 0.92
IGL01959:Nms APN 1 38,981,006 (GRCm39) splice site probably benign
IGL02088:Nms APN 1 38,978,358 (GRCm39) utr 5 prime probably benign
IGL02810:Nms APN 1 38,987,725 (GRCm39) missense possibly damaging 0.94
IGL03001:Nms APN 1 38,980,993 (GRCm39) missense probably benign 0.12
alacrity UTSW 1 38,980,976 (GRCm39) missense probably benign 0.04
R1087:Nms UTSW 1 38,983,192 (GRCm39) critical splice donor site probably null
R3689:Nms UTSW 1 38,986,075 (GRCm39) splice site probably benign
R4426:Nms UTSW 1 38,978,377 (GRCm39) missense probably benign
R6910:Nms UTSW 1 38,980,976 (GRCm39) missense probably benign 0.04
R8848:Nms UTSW 1 38,978,391 (GRCm39) missense probably benign
R9108:Nms UTSW 1 38,985,147 (GRCm39) missense possibly damaging 0.78
R9493:Nms UTSW 1 38,980,982 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGTTGAGTGAACAAGCTTCC -3'
(R):5'- TTTGTATCTCAGGATAAGCCCAAG -3'

Sequencing Primer
(F):5'- GAGTGAACAAGCTTCCCTTTCAG -3'
(R):5'- GAAATACCCAACTTCAATGCTTAGAG -3'
Posted On 2019-06-26