Incidental Mutation 'R7258:Utp14b'
ID564387
Institutional Source Beutler Lab
Gene Symbol Utp14b
Ensembl Gene ENSMUSG00000079470
Gene NameUTP14B small subunit processome component
Synonyms4932411L21Rik, jsd
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7258 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location78658038-78671512 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78664974 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 196 (H196Q)
Ref Sequence ENSEMBL: ENSMUSP00000052149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035779] [ENSMUST00000053760] [ENSMUST00000134566] [ENSMUST00000142704] [ENSMUST00000151622]
Predicted Effect probably benign
Transcript: ENSMUST00000035779
SMART Domains Protein: ENSMUSP00000045291
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053760
AA Change: H196Q

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000052149
Gene: ENSMUSG00000079470
AA Change: H196Q

DomainStartEndE-ValueType
Pfam:Utp14 39 744 6.4e-205 PFAM
low complexity region 758 778 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134566
SMART Domains Protein: ENSMUSP00000117952
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
Pfam:AMP-binding 1 435 4.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142704
SMART Domains Protein: ENSMUSP00000121695
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2.5e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151622
AA Change: H196Q

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121391
Gene: ENSMUSG00000079470
AA Change: H196Q

DomainStartEndE-ValueType
Pfam:Utp14 45 743 6e-163 PFAM
low complexity region 758 778 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (63/64)
MGI Phenotype PHENOTYPE: Homozygous males are sterile with spermatogonial arrest and elevated intratesticular testosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik A C 1: 87,475,067 I40L probably benign Het
4933402J07Rik A C 8: 87,586,177 S197R probably damaging Het
Abcc12 T C 8: 86,560,857 R120G possibly damaging Het
Abhd14b A G 9: 106,450,219 I67V probably benign Het
Alpk1 A T 3: 127,724,466 V62E probably damaging Het
Ankar A G 1: 72,651,727 V1196A probably benign Het
B230118H07Rik T C 2: 101,610,592 D22G probably null Het
Ccr5 A T 9: 124,125,274 K305* probably null Het
Cdc42bpb T C 12: 111,326,084 H339R probably damaging Het
Cep290 T G 10: 100,499,108 M330R probably benign Het
Cyfip2 T C 11: 46,224,177 Y901C probably benign Het
Ddx54 T G 5: 120,620,747 Y352D probably damaging Het
Defa35 A T 8: 21,065,229 H55L possibly damaging Het
Dnmt3b T A 2: 153,683,599 probably null Het
Enpep A C 3: 129,332,075 L136R probably benign Het
Epb41l2 G A 10: 25,484,287 A516T probably damaging Het
Frmd4a A T 2: 4,300,953 Q13L probably benign Het
Frmpd1 C A 4: 45,269,974 D271E possibly damaging Het
Gbp5 T A 3: 142,506,781 L410H probably damaging Het
Gipc2 T C 3: 152,165,715 E58G probably damaging Het
Gm281 A T 14: 13,899,648 F91L Het
Gm6309 A T 5: 146,168,296 V269E probably benign Het
Grm5 A T 7: 88,074,706 T735S probably damaging Het
H6pd T C 4: 149,996,362 M9V probably benign Het
Hmcn1 A G 1: 150,715,823 I1875T probably benign Het
Hrc T A 7: 45,336,296 D290E possibly damaging Het
Ippk C A 13: 49,433,862 Q136K probably benign Het
Kcnv1 T C 15: 45,109,315 T391A probably damaging Het
Kdm5b A C 1: 134,621,021 E1088A probably damaging Het
L1td1 C T 4: 98,736,864 A432V probably benign Het
Ly86 A G 13: 37,345,497 D20G probably benign Het
Myo1g A G 11: 6,509,416 I818T possibly damaging Het
Nms A G 1: 38,946,970 T121A probably benign Het
Olfr1084 T A 2: 86,639,001 K236* probably null Het
Olfr1414 A T 1: 92,511,176 I284N possibly damaging Het
Olfr350 T A 2: 36,850,340 I98K probably damaging Het
Olfr391-ps T G 11: 73,799,380 I126L probably damaging Het
Olfr609 G C 7: 103,492,589 C96W probably damaging Het
Olfr816 T A 10: 129,912,287 probably benign Het
Pcdhb9 T C 18: 37,402,114 L387P probably damaging Het
Pcsk1 G A 13: 75,093,186 R95H probably damaging Het
Pde11a T C 2: 76,139,906 D502G possibly damaging Het
Plekhg2 T C 7: 28,364,778 D446G probably benign Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rasal2 A T 1: 157,157,700 L826M probably damaging Het
Rnf213 A G 11: 119,452,575 I3589V Het
Sin3b T C 8: 72,750,208 C757R probably benign Het
Slc41a1 T A 1: 131,842,042 V300D probably benign Het
Snrpa1 T C 7: 66,070,143 F162L probably damaging Het
Sox30 C A 11: 45,980,552 A78E unknown Het
Ssc4d G T 5: 135,963,087 A401E probably damaging Het
Steap3 A G 1: 120,243,986 F130L possibly damaging Het
Stx5a A G 19: 8,754,907 probably null Het
Tgfbr2 A T 9: 116,129,830 I172N probably damaging Het
Tgm4 A G 9: 123,062,491 D557G probably benign Het
Tmprss11c A G 5: 86,271,413 S96P probably damaging Het
Trpa1 T G 1: 14,903,249 T282P probably damaging Het
Uba5 A T 9: 104,062,933 V5E unknown Het
Ugt2b36 A T 5: 87,080,903 L427H probably damaging Het
Vmn2r44 T A 7: 8,377,849 L348F probably damaging Het
Vmn2r93 T G 17: 18,305,141 L354V probably benign Het
Wwc2 T A 8: 47,842,999 N1079Y unknown Het
Zfp653 T C 9: 22,065,820 D145G probably benign Het
Zfp777 T C 6: 48,025,797 E453G probably damaging Het
Zfp936 T A 7: 43,190,379 H423Q probably damaging Het
Zfyve9 A T 4: 108,656,954 Y496N possibly damaging Het
Other mutations in Utp14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Utp14b APN 1 78664545 missense probably damaging 1.00
IGL01837:Utp14b APN 1 78664919 missense probably damaging 1.00
IGL02895:Utp14b APN 1 78664607 missense possibly damaging 0.61
IGL03165:Utp14b APN 1 78664520 missense probably damaging 0.97
IGL03210:Utp14b APN 1 78665551 missense probably benign 0.02
R0662:Utp14b UTSW 1 78664999 missense probably damaging 1.00
R0671:Utp14b UTSW 1 78664735 missense probably benign 0.00
R0736:Utp14b UTSW 1 78665272 missense probably damaging 1.00
R1180:Utp14b UTSW 1 78665445 missense probably damaging 1.00
R1430:Utp14b UTSW 1 78666394 missense probably benign 0.25
R1448:Utp14b UTSW 1 78665445 missense probably damaging 1.00
R1641:Utp14b UTSW 1 78665939 missense probably benign 0.08
R1867:Utp14b UTSW 1 78665431 missense probably damaging 1.00
R3054:Utp14b UTSW 1 78664725 missense possibly damaging 0.91
R3055:Utp14b UTSW 1 78664725 missense possibly damaging 0.91
R3056:Utp14b UTSW 1 78664725 missense possibly damaging 0.91
R3426:Utp14b UTSW 1 78665339 missense probably damaging 1.00
R3744:Utp14b UTSW 1 78665256 missense probably benign 0.03
R4204:Utp14b UTSW 1 78664822 missense probably benign 0.12
R5570:Utp14b UTSW 1 78665401 missense probably damaging 1.00
R5574:Utp14b UTSW 1 78666409 missense probably damaging 1.00
R5958:Utp14b UTSW 1 78664942 nonsense probably null
R5958:Utp14b UTSW 1 78664943 missense probably damaging 1.00
R6173:Utp14b UTSW 1 78665837 missense probably benign 0.03
R6173:Utp14b UTSW 1 78665840 missense probably benign 0.00
R7784:Utp14b UTSW 1 78664943 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCATTATCTTCGGTGGCTGC -3'
(R):5'- AATAGGACTGTAGAGCTCGCG -3'

Sequencing Primer
(F):5'- ACAGCTGCATAGAGTCAAGTC -3'
(R):5'- TAGAGCTCGCGTCCTCTGAAG -3'
Posted On2019-06-26