Incidental Mutation 'R7258:Steap3'
ID564390
Institutional Source Beutler Lab
Gene Symbol Steap3
Ensembl Gene ENSMUSG00000026389
Gene NameSTEAP family member 3
SynonymspHyde, 1010001D01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7258 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location120190757-120272705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120243986 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 130 (F130L)
Ref Sequence ENSEMBL: ENSMUSP00000108262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112639] [ENSMUST00000112640] [ENSMUST00000112641] [ENSMUST00000112643] [ENSMUST00000140490]
Predicted Effect probably benign
Transcript: ENSMUST00000112639
AA Change: F92L

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108258
Gene: ENSMUSG00000026389
AA Change: F92L

DomainStartEndE-ValueType
Pfam:F420_oxidored 30 117 5.7e-19 PFAM
Pfam:Ferric_reduct 259 407 1.2e-19 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112640
AA Change: F92L

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108259
Gene: ENSMUSG00000026389
AA Change: F92L

DomainStartEndE-ValueType
Pfam:F420_oxidored 30 117 5.7e-19 PFAM
Pfam:Ferric_reduct 259 407 1.2e-19 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112641
AA Change: F92L

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108260
Gene: ENSMUSG00000026389
AA Change: F92L

DomainStartEndE-ValueType
Pfam:F420_oxidored 30 117 5.7e-19 PFAM
Pfam:Ferric_reduct 259 407 1.2e-19 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112643
AA Change: F130L

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108262
Gene: ENSMUSG00000026389
AA Change: F130L

DomainStartEndE-ValueType
Pfam:F420_oxidored 68 155 7.3e-19 PFAM
Pfam:Ferric_reduct 297 445 7.9e-15 PFAM
transmembrane domain 470 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140490
AA Change: F92L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000121046
Gene: ENSMUSG00000026389
AA Change: F92L

DomainStartEndE-ValueType
Pfam:F420_oxidored 30 117 1.6e-18 PFAM
Pfam:Ferric_reduct 259 406 3.6e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multipass membrane protein that functions as an iron transporter. The encoded protein can reduce both iron (Fe3+) and copper (Cu2+) cations. This protein may mediate downstream responses to p53, including promoting apoptosis. Deficiency in this gene can cause anemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous inactivation of this gene results in microcytic anemia, increased erythrocyte cell number, abnormal reticulocyte morphology, anisopoikilocytosis, decreased mean corpuscular hemoglobin, decreased mean corpuscular volume, and thrombocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik A C 1: 87,475,067 I40L probably benign Het
4933402J07Rik A C 8: 87,586,177 S197R probably damaging Het
Abcc12 T C 8: 86,560,857 R120G possibly damaging Het
Abhd14b A G 9: 106,450,219 I67V probably benign Het
Alpk1 A T 3: 127,724,466 V62E probably damaging Het
Ankar A G 1: 72,651,727 V1196A probably benign Het
B230118H07Rik T C 2: 101,610,592 D22G probably null Het
Ccr5 A T 9: 124,125,274 K305* probably null Het
Cdc42bpb T C 12: 111,326,084 H339R probably damaging Het
Cep290 T G 10: 100,499,108 M330R probably benign Het
Cyfip2 T C 11: 46,224,177 Y901C probably benign Het
Ddx54 T G 5: 120,620,747 Y352D probably damaging Het
Defa35 A T 8: 21,065,229 H55L possibly damaging Het
Dnmt3b T A 2: 153,683,599 probably null Het
Enpep A C 3: 129,332,075 L136R probably benign Het
Epb41l2 G A 10: 25,484,287 A516T probably damaging Het
Frmd4a A T 2: 4,300,953 Q13L probably benign Het
Frmpd1 C A 4: 45,269,974 D271E possibly damaging Het
Gbp5 T A 3: 142,506,781 L410H probably damaging Het
Gipc2 T C 3: 152,165,715 E58G probably damaging Het
Gm281 A T 14: 13,899,648 F91L Het
Gm6309 A T 5: 146,168,296 V269E probably benign Het
Grm5 A T 7: 88,074,706 T735S probably damaging Het
H6pd T C 4: 149,996,362 M9V probably benign Het
Hmcn1 A G 1: 150,715,823 I1875T probably benign Het
Hrc T A 7: 45,336,296 D290E possibly damaging Het
Ippk C A 13: 49,433,862 Q136K probably benign Het
Kcnv1 T C 15: 45,109,315 T391A probably damaging Het
Kdm5b A C 1: 134,621,021 E1088A probably damaging Het
L1td1 C T 4: 98,736,864 A432V probably benign Het
Ly86 A G 13: 37,345,497 D20G probably benign Het
Myo1g A G 11: 6,509,416 I818T possibly damaging Het
Nms A G 1: 38,946,970 T121A probably benign Het
Olfr1084 T A 2: 86,639,001 K236* probably null Het
Olfr1414 A T 1: 92,511,176 I284N possibly damaging Het
Olfr350 T A 2: 36,850,340 I98K probably damaging Het
Olfr391-ps T G 11: 73,799,380 I126L probably damaging Het
Olfr609 G C 7: 103,492,589 C96W probably damaging Het
Olfr816 T A 10: 129,912,287 probably benign Het
Pcdhb9 T C 18: 37,402,114 L387P probably damaging Het
Pcsk1 G A 13: 75,093,186 R95H probably damaging Het
Pde11a T C 2: 76,139,906 D502G possibly damaging Het
Plekhg2 T C 7: 28,364,778 D446G probably benign Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rasal2 A T 1: 157,157,700 L826M probably damaging Het
Rnf213 A G 11: 119,452,575 I3589V Het
Sin3b T C 8: 72,750,208 C757R probably benign Het
Slc41a1 T A 1: 131,842,042 V300D probably benign Het
Snrpa1 T C 7: 66,070,143 F162L probably damaging Het
Sox30 C A 11: 45,980,552 A78E unknown Het
Ssc4d G T 5: 135,963,087 A401E probably damaging Het
Stx5a A G 19: 8,754,907 probably null Het
Tgfbr2 A T 9: 116,129,830 I172N probably damaging Het
Tgm4 A G 9: 123,062,491 D557G probably benign Het
Tmprss11c A G 5: 86,271,413 S96P probably damaging Het
Trpa1 T G 1: 14,903,249 T282P probably damaging Het
Uba5 A T 9: 104,062,933 V5E unknown Het
Ugt2b36 A T 5: 87,080,903 L427H probably damaging Het
Utp14b T A 1: 78,664,974 H196Q probably benign Het
Vmn2r44 T A 7: 8,377,849 L348F probably damaging Het
Vmn2r93 T G 17: 18,305,141 L354V probably benign Het
Wwc2 T A 8: 47,842,999 N1079Y unknown Het
Zfp653 T C 9: 22,065,820 D145G probably benign Het
Zfp777 T C 6: 48,025,797 E453G probably damaging Het
Zfp936 T A 7: 43,190,379 H423Q probably damaging Het
Zfyve9 A T 4: 108,656,954 Y496N possibly damaging Het
Other mutations in Steap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01898:Steap3 APN 1 120241574 missense probably benign 0.02
IGL02307:Steap3 APN 1 120241660 nonsense probably null
IGL02413:Steap3 APN 1 120241772 missense probably damaging 0.99
IGL03237:Steap3 APN 1 120243790 missense probably damaging 1.00
R0076:Steap3 UTSW 1 120227730 missense probably damaging 1.00
R0157:Steap3 UTSW 1 120227649 makesense probably null
R0468:Steap3 UTSW 1 120234300 missense probably damaging 1.00
R0507:Steap3 UTSW 1 120241583 missense possibly damaging 0.78
R0727:Steap3 UTSW 1 120227817 missense possibly damaging 0.91
R0742:Steap3 UTSW 1 120241583 missense possibly damaging 0.78
R1439:Steap3 UTSW 1 120227820 missense probably damaging 1.00
R1728:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1728:Steap3 UTSW 1 120234378 missense probably benign
R1729:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1729:Steap3 UTSW 1 120234378 missense probably benign
R1730:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1730:Steap3 UTSW 1 120234378 missense probably benign
R1739:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1739:Steap3 UTSW 1 120234378 missense probably benign
R1762:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1762:Steap3 UTSW 1 120234378 missense probably benign
R1783:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1783:Steap3 UTSW 1 120234378 missense probably benign
R1785:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1785:Steap3 UTSW 1 120234378 missense probably benign
R1902:Steap3 UTSW 1 120241734 missense probably benign
R3827:Steap3 UTSW 1 120227730 missense probably damaging 1.00
R4574:Steap3 UTSW 1 120241456 missense probably benign 0.00
R4805:Steap3 UTSW 1 120243886 missense probably benign 0.04
R5176:Steap3 UTSW 1 120243767 critical splice donor site probably null
R5285:Steap3 UTSW 1 120241880 missense probably damaging 0.98
R5481:Steap3 UTSW 1 120241724 missense probably benign
R5906:Steap3 UTSW 1 120244001 missense probably damaging 1.00
R6038:Steap3 UTSW 1 120241641 missense probably damaging 1.00
R6038:Steap3 UTSW 1 120241641 missense probably damaging 1.00
R6922:Steap3 UTSW 1 120243894 missense probably damaging 1.00
R7278:Steap3 UTSW 1 120234357 missense probably damaging 0.97
R7315:Steap3 UTSW 1 120227912 missense probably benign 0.01
R7439:Steap3 UTSW 1 120241518 missense probably benign 0.31
R7440:Steap3 UTSW 1 120241518 missense probably benign 0.31
R7441:Steap3 UTSW 1 120241518 missense probably benign 0.31
R7444:Steap3 UTSW 1 120241518 missense probably benign 0.31
R7452:Steap3 UTSW 1 120227855 missense possibly damaging 0.47
Z1176:Steap3 UTSW 1 120241623 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGATGACGTTGAAGGCCTTC -3'
(R):5'- TGGACAGTGATGGCAGTCTG -3'

Sequencing Primer
(F):5'- TGAAGGCCTTCACCACAGTG -3'
(R):5'- AAAGTGGGCATCCTGGGC -3'
Posted On2019-06-26