Mutagenetix > Incidental Mutations

Incidental Mutation 'R7258:Rasal2'

564394

Institutional Source

Beutler Lab

Gene Symbol

Rasal2

Ensembl Gene

ENSMUSG00000070565

Gene Name

RAS protein activator like 2

Synonyms

A330066M24Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7258 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

157135182-157412595 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 157157700 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Methionine at position 826 (L826M)

Ref Sequence

ENSEMBL: ENSMUSP00000077423 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078308] [ENSMUST00000132699]

Predicted Effect

probably damaging
Transcript: ENSMUST00000078308
AA Change: L826M

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000077423
Gene: ENSMUSG00000070565
AA Change: L826M

Domain	Start	End	E-Value	Type
low complexity region	36	47	N/A	INTRINSIC
PH	58	307	3.97e-8	SMART
C2	317	413	6.01e-10	SMART
RasGAP	423	767	4.56e-157	SMART
low complexity region	780	791	N/A	INTRINSIC
low complexity region	1063	1075	N/A	INTRINSIC
low complexity region	1084	1092	N/A	INTRINSIC
coiled coil region	1117	1236	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000132699
AA Change: L801M

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000114964
Gene: ENSMUSG00000070565
AA Change: L801M

Domain	Start	End	E-Value	Type
low complexity region	18	29	N/A	INTRINSIC
PH	40	289	1.7e-10	SMART
C2	299	395	4e-12	SMART
RasGAP	405	742	4.2e-153	SMART
low complexity region	755	766	N/A	INTRINSIC
low complexity region	1038	1050	N/A	INTRINSIC
low complexity region	1059	1067	N/A	INTRINSIC
coiled coil region	1092	1211	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains the GAP-related domain (GRD), a characteristic domain of GTPase-activating proteins (GAPs). GAPs function as activators of Ras superfamily of small GTPases. The protein encoded by this gene is able to complement the defective RasGAP function in a yeast system. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced survival and decreased tumor latency. In other tumorigenic models, this allele promotes increase metastatic potential. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110079O15Rik	A	C	1: 87,475,067	I40L	probably benign	Het
4933402J07Rik	A	C	8: 87,586,177	S197R	probably damaging	Het
Abcc12	T	C	8: 86,560,857	R120G	possibly damaging	Het
Abhd14b	A	G	9: 106,450,219	I67V	probably benign	Het
Alpk1	A	T	3: 127,724,466	V62E	probably damaging	Het
Ankar	A	G	1: 72,651,727	V1196A	probably benign	Het
B230118H07Rik	T	C	2: 101,610,592	D22G	probably null	Het
Ccr5	A	T	9: 124,125,274	K305*	probably null	Het
Cdc42bpb	T	C	12: 111,326,084	H339R	probably damaging	Het
Cep290	T	G	10: 100,499,108	M330R	probably benign	Het
Cyfip2	T	C	11: 46,224,177	Y901C	probably benign	Het
Ddx54	T	G	5: 120,620,747	Y352D	probably damaging	Het
Defa35	A	T	8: 21,065,229	H55L	possibly damaging	Het
Dnmt3b	T	A	2: 153,683,599		probably null	Het
Enpep	A	C	3: 129,332,075	L136R	probably benign	Het
Epb41l2	G	A	10: 25,484,287	A516T	probably damaging	Het
Frmd4a	A	T	2: 4,300,953	Q13L	probably benign	Het
Frmpd1	C	A	4: 45,269,974	D271E	possibly damaging	Het
Gbp5	T	A	3: 142,506,781	L410H	probably damaging	Het
Gipc2	T	C	3: 152,165,715	E58G	probably damaging	Het
Gm281	A	T	14: 13,899,648	F91L		Het
Gm6309	A	T	5: 146,168,296	V269E	probably benign	Het
Grm5	A	T	7: 88,074,706	T735S	probably damaging	Het
H6pd	T	C	4: 149,996,362	M9V	probably benign	Het
Hmcn1	A	G	1: 150,715,823	I1875T	probably benign	Het
Hrc	T	A	7: 45,336,296	D290E	possibly damaging	Het
Ippk	C	A	13: 49,433,862	Q136K	probably benign	Het
Kcnv1	T	C	15: 45,109,315	T391A	probably damaging	Het
Kdm5b	A	C	1: 134,621,021	E1088A	probably damaging	Het
L1td1	C	T	4: 98,736,864	A432V	probably benign	Het
Ly86	A	G	13: 37,345,497	D20G	probably benign	Het
Myo1g	A	G	11: 6,509,416	I818T	possibly damaging	Het
Nms	A	G	1: 38,946,970	T121A	probably benign	Het
Olfr1084	T	A	2: 86,639,001	K236*	probably null	Het
Olfr1414	A	T	1: 92,511,176	I284N	possibly damaging	Het
Olfr350	T	A	2: 36,850,340	I98K	probably damaging	Het
Olfr391-ps	T	G	11: 73,799,380	I126L	probably damaging	Het
Olfr609	G	C	7: 103,492,589	C96W	probably damaging	Het
Olfr816	T	A	10: 129,912,287		probably benign	Het
Pcdhb9	T	C	18: 37,402,114	L387P	probably damaging	Het
Pcsk1	G	A	13: 75,093,186	R95H	probably damaging	Het
Pde11a	T	C	2: 76,139,906	D502G	possibly damaging	Het
Plekhg2	T	C	7: 28,364,778	D446G	probably benign	Het
Ptch1	T	C	13: 63,573,294	K54E	not run	Het
Rnf213	A	G	11: 119,452,575	I3589V		Het
Sin3b	T	C	8: 72,750,208	C757R	probably benign	Het
Slc41a1	T	A	1: 131,842,042	V300D	probably benign	Het
Snrpa1	T	C	7: 66,070,143	F162L	probably damaging	Het
Sox30	C	A	11: 45,980,552	A78E	unknown	Het
Ssc4d	G	T	5: 135,963,087	A401E	probably damaging	Het
Steap3	A	G	1: 120,243,986	F130L	possibly damaging	Het
Stx5a	A	G	19: 8,754,907		probably null	Het
Tgfbr2	A	T	9: 116,129,830	I172N	probably damaging	Het
Tgm4	A	G	9: 123,062,491	D557G	probably benign	Het
Tmprss11c	A	G	5: 86,271,413	S96P	probably damaging	Het
Trpa1	T	G	1: 14,903,249	T282P	probably damaging	Het
Uba5	A	T	9: 104,062,933	V5E	unknown	Het
Ugt2b36	A	T	5: 87,080,903	L427H	probably damaging	Het
Utp14b	T	A	1: 78,664,974	H196Q	probably benign	Het
Vmn2r44	T	A	7: 8,377,849	L348F	probably damaging	Het
Vmn2r93	T	G	17: 18,305,141	L354V	probably benign	Het
Wwc2	T	A	8: 47,842,999	N1079Y	unknown	Het
Zfp653	T	C	9: 22,065,820	D145G	probably benign	Het
Zfp777	T	C	6: 48,025,797	E453G	probably damaging	Het
Zfp936	T	A	7: 43,190,379	H423Q	probably damaging	Het
Zfyve9	A	T	4: 108,656,954	Y496N	possibly damaging	Het

Other mutations in Rasal2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Rasal2	APN	1	157147817	missense	probably benign
IGL00484:Rasal2	APN	1	157174175	splice site	probably null
IGL00731:Rasal2	APN	1	157157764	missense	probably benign	0.01
IGL00900:Rasal2	APN	1	157411929	missense	possibly damaging	0.73
IGL01346:Rasal2	APN	1	157161216	missense	probably benign	0.19
IGL01635:Rasal2	APN	1	157163824	missense	probably damaging	1.00
IGL01759:Rasal2	APN	1	157175932	missense	probably benign	0.42
IGL01939:Rasal2	APN	1	157175910	missense	probably damaging	1.00
IGL01954:Rasal2	APN	1	157177699	missense	possibly damaging	0.83
IGL01954:Rasal2	APN	1	157176116	missense	probably damaging	0.99
IGL02005:Rasal2	APN	1	157156998	nonsense	probably null
IGL02056:Rasal2	APN	1	157299261	missense	probably damaging	0.99
IGL02444:Rasal2	APN	1	157299195	missense	probably benign	0.20
IGL02496:Rasal2	APN	1	157149879	missense	possibly damaging	0.69
IGL02832:Rasal2	APN	1	157157207	missense	probably damaging	1.00
IGL03351:Rasal2	APN	1	157192741	splice site	probably benign
R0456:Rasal2	UTSW	1	157149843	missense	probably damaging	1.00
R0537:Rasal2	UTSW	1	157147792	missense	possibly damaging	0.46
R0681:Rasal2	UTSW	1	157157180	missense	possibly damaging	0.70
R0682:Rasal2	UTSW	1	157179209	missense	probably damaging	1.00
R0683:Rasal2	UTSW	1	157179209	missense	probably damaging	1.00
R0787:Rasal2	UTSW	1	157158696	missense	probably damaging	1.00
R0789:Rasal2	UTSW	1	157157321	missense	probably damaging	1.00
R1109:Rasal2	UTSW	1	157177638	unclassified	probably benign
R1175:Rasal2	UTSW	1	157147648	missense	probably damaging	1.00
R1332:Rasal2	UTSW	1	157175821	missense	probably benign	0.00
R1396:Rasal2	UTSW	1	157164666	missense	probably damaging	1.00
R1535:Rasal2	UTSW	1	157230059	missense	probably benign	0.28
R1542:Rasal2	UTSW	1	157175851	missense	possibly damaging	0.84
R1703:Rasal2	UTSW	1	157157600	missense	probably damaging	1.00
R1735:Rasal2	UTSW	1	157174160	missense	probably damaging	1.00
R1762:Rasal2	UTSW	1	157299144	missense	possibly damaging	0.52
R2570:Rasal2	UTSW	1	157161300	missense	possibly damaging	0.85
R3148:Rasal2	UTSW	1	157243764	intron	probably benign
R3157:Rasal2	UTSW	1	157158655	splice site	probably benign
R4277:Rasal2	UTSW	1	157157126	missense	possibly damaging	0.46
R4459:Rasal2	UTSW	1	157175832	missense	possibly damaging	0.46
R4460:Rasal2	UTSW	1	157175832	missense	possibly damaging	0.46
R4563:Rasal2	UTSW	1	157175991	missense	probably damaging	1.00
R4672:Rasal2	UTSW	1	157243661	missense	probably benign	0.10
R4894:Rasal2	UTSW	1	157192804	missense	probably damaging	0.97
R5147:Rasal2	UTSW	1	157175694	missense	probably damaging	1.00
R5387:Rasal2	UTSW	1	157157765	missense	possibly damaging	0.81
R5421:Rasal2	UTSW	1	157299141	missense	probably benign	0.37
R5459:Rasal2	UTSW	1	157157661	missense	probably damaging	0.99
R5651:Rasal2	UTSW	1	157157381	missense	probably damaging	1.00
R5767:Rasal2	UTSW	1	157176162	missense	probably damaging	1.00
R5778:Rasal2	UTSW	1	157161290	missense	probably damaging	1.00
R6298:Rasal2	UTSW	1	157411862	missense	possibly damaging	0.85
R6332:Rasal2	UTSW	1	157299187	missense	probably damaging	1.00
R6571:Rasal2	UTSW	1	157161179	missense	possibly damaging	0.72
R7545:Rasal2	UTSW	1	157192769	missense	possibly damaging	0.93
R7558:Rasal2	UTSW	1	157175836	missense	probably damaging	0.99
R7894:Rasal2	UTSW	1	157243648	missense	probably benign	0.01
R8140:Rasal2	UTSW	1	157299235	missense	probably damaging	0.97
R8141:Rasal2	UTSW	1	157164670	missense	possibly damaging	0.89
R8151:Rasal2	UTSW	1	157243584	missense	probably damaging	0.96
R8218:Rasal2	UTSW	1	157157381	missense	probably damaging	0.99
R8517:Rasal2	UTSW	1	157146279	critical splice acceptor site	probably null
RF024:Rasal2	UTSW	1	157147790	missense	probably damaging	0.97
Z1177:Rasal2	UTSW	1	157175673	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCACTTGAGGTGCACTCTG -3'
(R):5'- CGCATTGAACCTGTGAAACTTC -3'

Sequencing Primer
(F):5'- ATAGAAAGCTGGCTTCCTGC -3'
(R):5'- ACTTCAGAAGAGTTCATATGCCC -3'

Posted On

2019-06-26