Incidental Mutation 'R7258:Olfr350'
ID 564396
Institutional Source Beutler Lab
Gene Symbol Olfr350
Ensembl Gene ENSMUSG00000050015
Gene Name olfactory receptor 350
Synonyms MOR136-13, GA_x6K02T2NLDC-33544602-33545540
MMRRC Submission
Accession Numbers

Genbank: NM_146627; MGI: 3030184

Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock # R7258 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 36846310-36851702 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 36850340 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 98 (I98K)
Ref Sequence ENSEMBL: ENSMUSP00000150158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055130] [ENSMUST00000214457] [ENSMUST00000215100]
AlphaFold Q8VFP8
Predicted Effect probably damaging
Transcript: ENSMUST00000055130
AA Change: I98K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053105
Gene: ENSMUSG00000050015
AA Change: I98K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.3e-61 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.3e-7 PFAM
Pfam:7tm_1 41 290 3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214457
AA Change: I98K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000215100
AA Change: I98K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik A C 1: 87,475,067 I40L probably benign Het
4933402J07Rik A C 8: 87,586,177 S197R probably damaging Het
Abcc12 T C 8: 86,560,857 R120G possibly damaging Het
Abhd14b A G 9: 106,450,219 I67V probably benign Het
Alpk1 A T 3: 127,724,466 V62E probably damaging Het
Ankar A G 1: 72,651,727 V1196A probably benign Het
B230118H07Rik T C 2: 101,610,592 D22G probably null Het
Ccr5 A T 9: 124,125,274 K305* probably null Het
Cdc42bpb T C 12: 111,326,084 H339R probably damaging Het
Cep290 T G 10: 100,499,108 M330R probably benign Het
Cyfip2 T C 11: 46,224,177 Y901C probably benign Het
Ddx54 T G 5: 120,620,747 Y352D probably damaging Het
Defa35 A T 8: 21,065,229 H55L possibly damaging Het
Dnmt3b T A 2: 153,683,599 probably null Het
Enpep A C 3: 129,332,075 L136R probably benign Het
Epb41l2 G A 10: 25,484,287 A516T probably damaging Het
Frmd4a A T 2: 4,300,953 Q13L probably benign Het
Frmpd1 C A 4: 45,269,974 D271E possibly damaging Het
Gbp5 T A 3: 142,506,781 L410H probably damaging Het
Gipc2 T C 3: 152,165,715 E58G probably damaging Het
Gm281 A T 14: 13,899,648 F91L Het
Gm6309 A T 5: 146,168,296 V269E probably benign Het
Grm5 A T 7: 88,074,706 T735S probably damaging Het
H6pd T C 4: 149,996,362 M9V probably benign Het
Hmcn1 A G 1: 150,715,823 I1875T probably benign Het
Hrc T A 7: 45,336,296 D290E possibly damaging Het
Ippk C A 13: 49,433,862 Q136K probably benign Het
Kcnv1 T C 15: 45,109,315 T391A probably damaging Het
Kdm5b A C 1: 134,621,021 E1088A probably damaging Het
L1td1 C T 4: 98,736,864 A432V probably benign Het
Ly86 A G 13: 37,345,497 D20G probably benign Het
Myo1g A G 11: 6,509,416 I818T possibly damaging Het
Nms A G 1: 38,946,970 T121A probably benign Het
Olfr1084 T A 2: 86,639,001 K236* probably null Het
Olfr1414 A T 1: 92,511,176 I284N possibly damaging Het
Olfr391-ps T G 11: 73,799,380 I126L probably damaging Het
Olfr609 G C 7: 103,492,589 C96W probably damaging Het
Olfr816 T A 10: 129,912,287 probably benign Het
Pcdhb9 T C 18: 37,402,114 L387P probably damaging Het
Pcsk1 G A 13: 75,093,186 R95H probably damaging Het
Pde11a T C 2: 76,139,906 D502G possibly damaging Het
Plekhg2 T C 7: 28,364,778 D446G probably benign Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rasal2 A T 1: 157,157,700 L826M probably damaging Het
Rnf213 A G 11: 119,452,575 I3589V Het
Sin3b T C 8: 72,750,208 C757R probably benign Het
Slc41a1 T A 1: 131,842,042 V300D probably benign Het
Snrpa1 T C 7: 66,070,143 F162L probably damaging Het
Sox30 C A 11: 45,980,552 A78E unknown Het
Ssc4d G T 5: 135,963,087 A401E probably damaging Het
Steap3 A G 1: 120,243,986 F130L possibly damaging Het
Stx5a A G 19: 8,754,907 probably null Het
Tgfbr2 A T 9: 116,129,830 I172N probably damaging Het
Tgm4 A G 9: 123,062,491 D557G probably benign Het
Tmprss11c A G 5: 86,271,413 S96P probably damaging Het
Trpa1 T G 1: 14,903,249 T282P probably damaging Het
Uba5 A T 9: 104,062,933 V5E unknown Het
Ugt2b36 A T 5: 87,080,903 L427H probably damaging Het
Utp14b T A 1: 78,664,974 H196Q probably benign Het
Vmn2r44 T A 7: 8,377,849 L348F probably damaging Het
Vmn2r93 T G 17: 18,305,141 L354V probably benign Het
Wwc2 T A 8: 47,842,999 N1079Y unknown Het
Zfp653 T C 9: 22,065,820 D145G probably benign Het
Zfp777 T C 6: 48,025,797 E453G probably damaging Het
Zfp936 T A 7: 43,190,379 H423Q probably damaging Het
Zfyve9 A T 4: 108,656,954 Y496N possibly damaging Het
Other mutations in Olfr350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Olfr350 APN 2 36850270 missense probably damaging 1.00
IGL01113:Olfr350 APN 2 36850619 missense probably damaging 1.00
IGL01393:Olfr350 APN 2 36850541 missense probably benign 0.01
IGL02302:Olfr350 APN 2 36850703 missense probably benign 0.02
IGL02316:Olfr350 APN 2 36850282 missense probably damaging 1.00
BB007:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
BB017:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
F6893:Olfr350 UTSW 2 36850807 missense probably benign 0.00
PIT4402001:Olfr350 UTSW 2 36850304 missense probably benign
R0312:Olfr350 UTSW 2 36850360 missense probably benign 0.01
R0525:Olfr350 UTSW 2 36850190 missense probably damaging 1.00
R0557:Olfr350 UTSW 2 36850748 missense possibly damaging 0.95
R0665:Olfr350 UTSW 2 36850190 missense probably damaging 1.00
R2019:Olfr350 UTSW 2 36850406 missense possibly damaging 0.95
R2107:Olfr350 UTSW 2 36850343 missense possibly damaging 0.54
R2108:Olfr350 UTSW 2 36850343 missense possibly damaging 0.54
R2848:Olfr350 UTSW 2 36850799 missense probably damaging 1.00
R3964:Olfr350 UTSW 2 36850717 missense probably benign 0.12
R4822:Olfr350 UTSW 2 36850876 missense probably benign 0.10
R4907:Olfr350 UTSW 2 36850258 missense probably benign 0.28
R5134:Olfr350 UTSW 2 36850476 missense probably benign 0.03
R5144:Olfr350 UTSW 2 36850144 missense probably benign
R5702:Olfr350 UTSW 2 36850934 missense probably damaging 1.00
R5727:Olfr350 UTSW 2 36850532 missense possibly damaging 0.80
R5786:Olfr350 UTSW 2 36850049 start codon destroyed probably null 0.98
R6179:Olfr350 UTSW 2 36850834 missense possibly damaging 0.59
R6862:Olfr350 UTSW 2 36850222 missense possibly damaging 0.95
R7307:Olfr350 UTSW 2 36850125 missense probably benign 0.00
R7353:Olfr350 UTSW 2 36850069 missense probably benign
R7412:Olfr350 UTSW 2 36850466 missense probably benign 0.28
R7851:Olfr350 UTSW 2 36850416 nonsense probably null
R7930:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
R8005:Olfr350 UTSW 2 36850144 missense probably benign
R8346:Olfr350 UTSW 2 36850339 missense probably benign 0.02
R8692:Olfr350 UTSW 2 36850084 missense probably benign 0.00
R9120:Olfr350 UTSW 2 36850131 nonsense probably null
R9318:Olfr350 UTSW 2 36850553 missense probably benign 0.12
Z1177:Olfr350 UTSW 2 36850239 missense probably damaging 0.99
Z1177:Olfr350 UTSW 2 36850925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTACCTGACAACTGTGCTGG -3'
(R):5'- GTCAGCACAGAAGGATAGCC -3'

Sequencing Primer
(F):5'- CTGACAACTGTGCTGGGGAAC -3'
(R):5'- CACAGAAGGATAGCCGGGCC -3'
Posted On 2019-06-26