Incidental Mutation 'R7258:Alpk1'
ID 564400
Institutional Source Beutler Lab
Gene Symbol Alpk1
Ensembl Gene ENSMUSG00000028028
Gene Name alpha-kinase 1
Synonyms 8430410J10Rik
MMRRC Submission 045386-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7258 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 127463959-127574176 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 127518115 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 62 (V62E)
Ref Sequence ENSEMBL: ENSMUSP00000029662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029662] [ENSMUST00000198955]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029662
AA Change: V62E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029662
Gene: ENSMUSG00000028028
AA Change: V62E

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
low complexity region 618 628 N/A INTRINSIC
low complexity region 700 714 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Alpha_kinase 1008 1215 1.03e-81 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198955
AA Change: V62E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143223
Gene: ENSMUSG00000028028
AA Change: V62E

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
low complexity region 618 628 N/A INTRINSIC
low complexity region 700 714 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Alpha_kinase 1008 1215 1.03e-81 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha kinase. Mice which were homozygous for disrupted copies of this gene exhibited coordination defects (PMID: 21208416). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik A C 8: 88,312,805 (GRCm39) S197R probably damaging Het
Abcc12 T C 8: 87,287,486 (GRCm39) R120G possibly damaging Het
Abhd14b A G 9: 106,327,418 (GRCm39) I67V probably benign Het
Ankar A G 1: 72,690,886 (GRCm39) V1196A probably benign Het
Ccr5 A T 9: 123,925,311 (GRCm39) K305* probably null Het
Cdc42bpb T C 12: 111,292,518 (GRCm39) H339R probably damaging Het
Cdhr18 A T 14: 13,899,648 (GRCm38) F91L Het
Cep290 T G 10: 100,334,970 (GRCm39) M330R probably benign Het
Cyfip2 T C 11: 46,115,004 (GRCm39) Y901C probably benign Het
Ddx54 T G 5: 120,758,812 (GRCm39) Y352D probably damaging Het
Defa35 A T 8: 21,555,245 (GRCm39) H55L possibly damaging Het
Dnmt3b T A 2: 153,525,519 (GRCm39) probably null Het
Enpep A C 3: 129,125,724 (GRCm39) L136R probably benign Het
Epb41l2 G A 10: 25,360,185 (GRCm39) A516T probably damaging Het
Frmd4a A T 2: 4,305,764 (GRCm39) Q13L probably benign Het
Frmpd1 C A 4: 45,269,974 (GRCm39) D271E possibly damaging Het
Gbp5 T A 3: 142,212,542 (GRCm39) L410H probably damaging Het
Gipc2 T C 3: 151,871,352 (GRCm39) E58G probably damaging Het
Gm6309 A T 5: 146,105,106 (GRCm39) V269E probably benign Het
Grm5 A T 7: 87,723,914 (GRCm39) T735S probably damaging Het
H6pd T C 4: 150,080,819 (GRCm39) M9V probably benign Het
Hmcn1 A G 1: 150,591,574 (GRCm39) I1875T probably benign Het
Hrc T A 7: 44,985,720 (GRCm39) D290E possibly damaging Het
Iftap T C 2: 101,440,937 (GRCm39) D22G probably null Het
Ippk C A 13: 49,587,338 (GRCm39) Q136K probably benign Het
Kcnv1 T C 15: 44,972,711 (GRCm39) T391A probably damaging Het
Kdm5b A C 1: 134,548,759 (GRCm39) E1088A probably damaging Het
L1td1 C T 4: 98,625,101 (GRCm39) A432V probably benign Het
Ly86 A G 13: 37,529,473 (GRCm39) D20G probably benign Het
Myo1g A G 11: 6,459,416 (GRCm39) I818T possibly damaging Het
Nms A G 1: 38,986,051 (GRCm39) T121A probably benign Het
Or1e31 T G 11: 73,690,206 (GRCm39) I126L probably damaging Het
Or1j4 T A 2: 36,740,352 (GRCm39) I98K probably damaging Het
Or51af1 G C 7: 103,141,796 (GRCm39) C96W probably damaging Het
Or6b3 A T 1: 92,438,898 (GRCm39) I284N possibly damaging Het
Or6c69 T A 10: 129,748,156 (GRCm39) probably benign Het
Or8k37 T A 2: 86,469,345 (GRCm39) K236* probably null Het
Pcdhb9 T C 18: 37,535,167 (GRCm39) L387P probably damaging Het
Pcsk1 G A 13: 75,241,305 (GRCm39) R95H probably damaging Het
Pde11a T C 2: 75,970,250 (GRCm39) D502G possibly damaging Het
Plekhg2 T C 7: 28,064,203 (GRCm39) D446G probably benign Het
Ptch1 T C 13: 63,721,108 (GRCm39) K54E not run Het
Rasal2 A T 1: 156,985,270 (GRCm39) L826M probably damaging Het
Rnf213 A G 11: 119,343,401 (GRCm39) I3589V Het
Sin3b T C 8: 73,476,836 (GRCm39) C757R probably benign Het
Slc41a1 T A 1: 131,769,780 (GRCm39) V300D probably benign Het
Snorc A C 1: 87,402,789 (GRCm39) I40L probably benign Het
Snrpa1 T C 7: 65,719,891 (GRCm39) F162L probably damaging Het
Sox30 C A 11: 45,871,379 (GRCm39) A78E unknown Het
Ssc4d G T 5: 135,991,941 (GRCm39) A401E probably damaging Het
Steap3 A G 1: 120,171,716 (GRCm39) F130L possibly damaging Het
Stx5a A G 19: 8,732,271 (GRCm39) probably null Het
Tgfbr2 A T 9: 115,958,898 (GRCm39) I172N probably damaging Het
Tgm4 A G 9: 122,891,556 (GRCm39) D557G probably benign Het
Tmprss11c A G 5: 86,419,272 (GRCm39) S96P probably damaging Het
Trpa1 T G 1: 14,973,473 (GRCm39) T282P probably damaging Het
Uba5 A T 9: 103,940,132 (GRCm39) V5E unknown Het
Ugt2b36 A T 5: 87,228,762 (GRCm39) L427H probably damaging Het
Utp14b T A 1: 78,642,691 (GRCm39) H196Q probably benign Het
Vmn2r44 T A 7: 8,380,848 (GRCm39) L348F probably damaging Het
Vmn2r93 T G 17: 18,525,403 (GRCm39) L354V probably benign Het
Wwc2 T A 8: 48,296,034 (GRCm39) N1079Y unknown Het
Zfp653 T C 9: 21,977,116 (GRCm39) D145G probably benign Het
Zfp777 T C 6: 48,002,731 (GRCm39) E453G probably damaging Het
Zfp936 T A 7: 42,839,803 (GRCm39) H423Q probably damaging Het
Zfyve9 A T 4: 108,514,151 (GRCm39) Y496N possibly damaging Het
Other mutations in Alpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Alpk1 APN 3 127,474,692 (GRCm39) missense probably damaging 1.00
IGL00722:Alpk1 APN 3 127,473,862 (GRCm39) missense probably benign 0.00
IGL01066:Alpk1 APN 3 127,473,874 (GRCm39) missense probably benign 0.22
IGL01351:Alpk1 APN 3 127,466,011 (GRCm39) missense probably damaging 0.97
IGL01412:Alpk1 APN 3 127,473,621 (GRCm39) missense possibly damaging 0.60
IGL01469:Alpk1 APN 3 127,471,401 (GRCm39) splice site probably null
IGL01585:Alpk1 APN 3 127,473,462 (GRCm39) missense probably benign 0.01
IGL02308:Alpk1 APN 3 127,522,931 (GRCm39) missense probably damaging 0.99
IGL02325:Alpk1 APN 3 127,473,552 (GRCm39) missense probably benign 0.43
IGL02458:Alpk1 APN 3 127,474,968 (GRCm39) critical splice donor site probably null
IGL02553:Alpk1 APN 3 127,466,970 (GRCm39) missense probably damaging 1.00
IGL02717:Alpk1 APN 3 127,474,749 (GRCm39) missense possibly damaging 0.76
IGL02729:Alpk1 APN 3 127,474,721 (GRCm39) missense possibly damaging 0.87
IGL02832:Alpk1 APN 3 127,473,592 (GRCm39) missense possibly damaging 0.63
IGL02892:Alpk1 APN 3 127,473,771 (GRCm39) missense possibly damaging 0.92
IGL03178:Alpk1 APN 3 127,473,870 (GRCm39) nonsense probably null
R0427:Alpk1 UTSW 3 127,464,720 (GRCm39) missense probably damaging 1.00
R0981:Alpk1 UTSW 3 127,473,051 (GRCm39) missense possibly damaging 0.62
R1174:Alpk1 UTSW 3 127,474,459 (GRCm39) missense probably damaging 0.99
R1793:Alpk1 UTSW 3 127,471,447 (GRCm39) missense probably damaging 1.00
R1859:Alpk1 UTSW 3 127,474,749 (GRCm39) missense possibly damaging 0.76
R2173:Alpk1 UTSW 3 127,477,239 (GRCm39) missense probably damaging 1.00
R2235:Alpk1 UTSW 3 127,474,569 (GRCm39) missense probably benign 0.01
R2373:Alpk1 UTSW 3 127,473,457 (GRCm39) missense probably benign 0.00
R3803:Alpk1 UTSW 3 127,473,486 (GRCm39) missense possibly damaging 0.93
R3927:Alpk1 UTSW 3 127,471,365 (GRCm39) missense probably damaging 1.00
R4356:Alpk1 UTSW 3 127,523,022 (GRCm39) missense probably damaging 0.98
R4357:Alpk1 UTSW 3 127,523,022 (GRCm39) missense probably damaging 0.98
R4358:Alpk1 UTSW 3 127,523,022 (GRCm39) missense probably damaging 0.98
R4379:Alpk1 UTSW 3 127,523,022 (GRCm39) missense probably damaging 0.98
R4381:Alpk1 UTSW 3 127,523,022 (GRCm39) missense probably damaging 0.98
R4470:Alpk1 UTSW 3 127,473,175 (GRCm39) missense probably damaging 1.00
R4471:Alpk1 UTSW 3 127,473,175 (GRCm39) missense probably damaging 1.00
R4473:Alpk1 UTSW 3 127,473,667 (GRCm39) missense probably damaging 0.97
R4474:Alpk1 UTSW 3 127,473,667 (GRCm39) missense probably damaging 0.97
R4476:Alpk1 UTSW 3 127,473,667 (GRCm39) missense probably damaging 0.97
R4512:Alpk1 UTSW 3 127,478,120 (GRCm39) intron probably benign
R4594:Alpk1 UTSW 3 127,477,203 (GRCm39) missense probably damaging 1.00
R4678:Alpk1 UTSW 3 127,473,507 (GRCm39) missense probably damaging 0.99
R4707:Alpk1 UTSW 3 127,481,241 (GRCm39) missense possibly damaging 0.50
R4784:Alpk1 UTSW 3 127,481,241 (GRCm39) missense possibly damaging 0.50
R4785:Alpk1 UTSW 3 127,481,241 (GRCm39) missense possibly damaging 0.50
R4820:Alpk1 UTSW 3 127,464,708 (GRCm39) missense probably benign 0.06
R4887:Alpk1 UTSW 3 127,467,124 (GRCm39) missense probably damaging 1.00
R5088:Alpk1 UTSW 3 127,478,969 (GRCm39) splice site probably benign
R5169:Alpk1 UTSW 3 127,464,750 (GRCm39) missense probably damaging 1.00
R5280:Alpk1 UTSW 3 127,474,813 (GRCm39) missense probably benign 0.00
R5351:Alpk1 UTSW 3 127,522,941 (GRCm39) missense probably damaging 0.96
R5478:Alpk1 UTSW 3 127,471,368 (GRCm39) missense probably damaging 1.00
R5627:Alpk1 UTSW 3 127,474,296 (GRCm39) missense probably damaging 0.99
R5781:Alpk1 UTSW 3 127,473,684 (GRCm39) missense possibly damaging 0.92
R5842:Alpk1 UTSW 3 127,474,618 (GRCm39) missense probably damaging 1.00
R5847:Alpk1 UTSW 3 127,473,723 (GRCm39) missense probably benign 0.06
R5940:Alpk1 UTSW 3 127,464,595 (GRCm39) missense probably benign
R6187:Alpk1 UTSW 3 127,466,991 (GRCm39) missense probably damaging 1.00
R6306:Alpk1 UTSW 3 127,479,965 (GRCm39) missense probably damaging 1.00
R6414:Alpk1 UTSW 3 127,473,858 (GRCm39) missense probably benign
R6701:Alpk1 UTSW 3 127,522,985 (GRCm39) missense probably damaging 1.00
R6735:Alpk1 UTSW 3 127,518,098 (GRCm39) missense probably damaging 1.00
R6850:Alpk1 UTSW 3 127,523,012 (GRCm39) missense possibly damaging 0.87
R7173:Alpk1 UTSW 3 127,478,024 (GRCm39) nonsense probably null
R7412:Alpk1 UTSW 3 127,489,382 (GRCm39) missense probably damaging 1.00
R7412:Alpk1 UTSW 3 127,466,143 (GRCm39) missense probably damaging 1.00
R7498:Alpk1 UTSW 3 127,473,427 (GRCm39) missense probably benign 0.22
R7635:Alpk1 UTSW 3 127,489,310 (GRCm39) missense probably benign 0.01
R7660:Alpk1 UTSW 3 127,474,616 (GRCm39) missense probably damaging 1.00
R7682:Alpk1 UTSW 3 127,466,195 (GRCm39) missense possibly damaging 0.94
R7732:Alpk1 UTSW 3 127,478,041 (GRCm39) missense
R7827:Alpk1 UTSW 3 127,473,700 (GRCm39) missense probably benign 0.00
R8029:Alpk1 UTSW 3 127,522,934 (GRCm39) missense possibly damaging 0.95
R8383:Alpk1 UTSW 3 127,518,085 (GRCm39) missense probably benign 0.41
R8478:Alpk1 UTSW 3 127,522,961 (GRCm39) missense probably damaging 1.00
R8765:Alpk1 UTSW 3 127,466,118 (GRCm39) missense probably damaging 1.00
R8816:Alpk1 UTSW 3 127,478,024 (GRCm39) nonsense probably null
R8907:Alpk1 UTSW 3 127,474,642 (GRCm39) nonsense probably null
R8972:Alpk1 UTSW 3 127,473,232 (GRCm39) missense probably damaging 1.00
R8974:Alpk1 UTSW 3 127,473,580 (GRCm39) missense probably benign 0.03
R9039:Alpk1 UTSW 3 127,473,192 (GRCm39) missense probably damaging 1.00
R9202:Alpk1 UTSW 3 127,479,938 (GRCm39) missense
R9394:Alpk1 UTSW 3 127,466,187 (GRCm39) missense probably damaging 1.00
R9421:Alpk1 UTSW 3 127,467,069 (GRCm39) missense probably damaging 1.00
R9436:Alpk1 UTSW 3 127,478,924 (GRCm39) missense
R9785:Alpk1 UTSW 3 127,473,594 (GRCm39) missense probably benign 0.22
Z1176:Alpk1 UTSW 3 127,467,087 (GRCm39) missense probably damaging 1.00
Z1177:Alpk1 UTSW 3 127,478,956 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AGGGGCTATCTTGTACTTCAGAG -3'
(R):5'- TCTTCAAGGCAGCTCCCAAC -3'

Sequencing Primer
(F):5'- CAGAGAAATTTAATCTGTGAGACCAC -3'
(R):5'- AACAGCTTGGGCCAGCC -3'
Posted On 2019-06-26