Incidental Mutation 'R7258:Frmpd1'
ID 564404
Institutional Source Beutler Lab
Gene Symbol Frmpd1
Ensembl Gene ENSMUSG00000035615
Gene Name FERM and PDZ domain containing 1
Synonyms
MMRRC Submission 045386-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7258 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 45184875-45285936 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 45269974 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 271 (D271E)
Ref Sequence ENSEMBL: ENSMUSP00000047232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044773] [ENSMUST00000107804]
AlphaFold A2AKB4
Predicted Effect possibly damaging
Transcript: ENSMUST00000044773
AA Change: D271E

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047232
Gene: ENSMUSG00000035615
AA Change: D271E

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000107804
AA Change: D271E

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103434
Gene: ENSMUSG00000035615
AA Change: D271E

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Meta Mutation Damage Score 0.1120 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik A C 8: 88,312,805 (GRCm39) S197R probably damaging Het
Abcc12 T C 8: 87,287,486 (GRCm39) R120G possibly damaging Het
Abhd14b A G 9: 106,327,418 (GRCm39) I67V probably benign Het
Alpk1 A T 3: 127,518,115 (GRCm39) V62E probably damaging Het
Ankar A G 1: 72,690,886 (GRCm39) V1196A probably benign Het
Ccr5 A T 9: 123,925,311 (GRCm39) K305* probably null Het
Cdc42bpb T C 12: 111,292,518 (GRCm39) H339R probably damaging Het
Cdhr18 A T 14: 13,899,648 (GRCm38) F91L Het
Cep290 T G 10: 100,334,970 (GRCm39) M330R probably benign Het
Cyfip2 T C 11: 46,115,004 (GRCm39) Y901C probably benign Het
Ddx54 T G 5: 120,758,812 (GRCm39) Y352D probably damaging Het
Defa35 A T 8: 21,555,245 (GRCm39) H55L possibly damaging Het
Dnmt3b T A 2: 153,525,519 (GRCm39) probably null Het
Enpep A C 3: 129,125,724 (GRCm39) L136R probably benign Het
Epb41l2 G A 10: 25,360,185 (GRCm39) A516T probably damaging Het
Frmd4a A T 2: 4,305,764 (GRCm39) Q13L probably benign Het
Gbp5 T A 3: 142,212,542 (GRCm39) L410H probably damaging Het
Gipc2 T C 3: 151,871,352 (GRCm39) E58G probably damaging Het
Gm6309 A T 5: 146,105,106 (GRCm39) V269E probably benign Het
Grm5 A T 7: 87,723,914 (GRCm39) T735S probably damaging Het
H6pd T C 4: 150,080,819 (GRCm39) M9V probably benign Het
Hmcn1 A G 1: 150,591,574 (GRCm39) I1875T probably benign Het
Hrc T A 7: 44,985,720 (GRCm39) D290E possibly damaging Het
Iftap T C 2: 101,440,937 (GRCm39) D22G probably null Het
Ippk C A 13: 49,587,338 (GRCm39) Q136K probably benign Het
Kcnv1 T C 15: 44,972,711 (GRCm39) T391A probably damaging Het
Kdm5b A C 1: 134,548,759 (GRCm39) E1088A probably damaging Het
L1td1 C T 4: 98,625,101 (GRCm39) A432V probably benign Het
Ly86 A G 13: 37,529,473 (GRCm39) D20G probably benign Het
Myo1g A G 11: 6,459,416 (GRCm39) I818T possibly damaging Het
Nms A G 1: 38,986,051 (GRCm39) T121A probably benign Het
Or1e31 T G 11: 73,690,206 (GRCm39) I126L probably damaging Het
Or1j4 T A 2: 36,740,352 (GRCm39) I98K probably damaging Het
Or51af1 G C 7: 103,141,796 (GRCm39) C96W probably damaging Het
Or6b3 A T 1: 92,438,898 (GRCm39) I284N possibly damaging Het
Or6c69 T A 10: 129,748,156 (GRCm39) probably benign Het
Or8k37 T A 2: 86,469,345 (GRCm39) K236* probably null Het
Pcdhb9 T C 18: 37,535,167 (GRCm39) L387P probably damaging Het
Pcsk1 G A 13: 75,241,305 (GRCm39) R95H probably damaging Het
Pde11a T C 2: 75,970,250 (GRCm39) D502G possibly damaging Het
Plekhg2 T C 7: 28,064,203 (GRCm39) D446G probably benign Het
Ptch1 T C 13: 63,721,108 (GRCm39) K54E not run Het
Rasal2 A T 1: 156,985,270 (GRCm39) L826M probably damaging Het
Rnf213 A G 11: 119,343,401 (GRCm39) I3589V Het
Sin3b T C 8: 73,476,836 (GRCm39) C757R probably benign Het
Slc41a1 T A 1: 131,769,780 (GRCm39) V300D probably benign Het
Snorc A C 1: 87,402,789 (GRCm39) I40L probably benign Het
Snrpa1 T C 7: 65,719,891 (GRCm39) F162L probably damaging Het
Sox30 C A 11: 45,871,379 (GRCm39) A78E unknown Het
Ssc4d G T 5: 135,991,941 (GRCm39) A401E probably damaging Het
Steap3 A G 1: 120,171,716 (GRCm39) F130L possibly damaging Het
Stx5a A G 19: 8,732,271 (GRCm39) probably null Het
Tgfbr2 A T 9: 115,958,898 (GRCm39) I172N probably damaging Het
Tgm4 A G 9: 122,891,556 (GRCm39) D557G probably benign Het
Tmprss11c A G 5: 86,419,272 (GRCm39) S96P probably damaging Het
Trpa1 T G 1: 14,973,473 (GRCm39) T282P probably damaging Het
Uba5 A T 9: 103,940,132 (GRCm39) V5E unknown Het
Ugt2b36 A T 5: 87,228,762 (GRCm39) L427H probably damaging Het
Utp14b T A 1: 78,642,691 (GRCm39) H196Q probably benign Het
Vmn2r44 T A 7: 8,380,848 (GRCm39) L348F probably damaging Het
Vmn2r93 T G 17: 18,525,403 (GRCm39) L354V probably benign Het
Wwc2 T A 8: 48,296,034 (GRCm39) N1079Y unknown Het
Zfp653 T C 9: 21,977,116 (GRCm39) D145G probably benign Het
Zfp777 T C 6: 48,002,731 (GRCm39) E453G probably damaging Het
Zfp936 T A 7: 42,839,803 (GRCm39) H423Q probably damaging Het
Zfyve9 A T 4: 108,514,151 (GRCm39) Y496N possibly damaging Het
Other mutations in Frmpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Frmpd1 APN 4 45,279,456 (GRCm39) missense possibly damaging 0.61
IGL01678:Frmpd1 APN 4 45,243,717 (GRCm39) missense probably damaging 1.00
IGL01815:Frmpd1 APN 4 45,284,239 (GRCm39) missense probably benign
IGL02305:Frmpd1 APN 4 45,249,209 (GRCm39) missense probably damaging 1.00
IGL02347:Frmpd1 APN 4 45,270,023 (GRCm39) splice site probably null
IGL02586:Frmpd1 APN 4 45,285,160 (GRCm39) missense probably damaging 1.00
IGL02704:Frmpd1 APN 4 45,285,082 (GRCm39) missense possibly damaging 0.83
IGL02942:Frmpd1 APN 4 45,285,493 (GRCm39) missense probably damaging 0.99
IGL03353:Frmpd1 APN 4 45,261,926 (GRCm39) missense probably damaging 1.00
IGL03355:Frmpd1 APN 4 45,279,140 (GRCm39) missense probably damaging 1.00
IGL03401:Frmpd1 APN 4 45,284,383 (GRCm39) missense probably benign 0.28
IGL03047:Frmpd1 UTSW 4 45,283,993 (GRCm39) missense probably damaging 1.00
R0094:Frmpd1 UTSW 4 45,284,899 (GRCm39) nonsense probably null
R0103:Frmpd1 UTSW 4 45,229,884 (GRCm39) missense probably damaging 0.99
R0103:Frmpd1 UTSW 4 45,229,884 (GRCm39) missense probably damaging 0.99
R0109:Frmpd1 UTSW 4 45,279,340 (GRCm39) missense probably benign 0.03
R0109:Frmpd1 UTSW 4 45,279,340 (GRCm39) missense probably benign 0.03
R0375:Frmpd1 UTSW 4 45,284,196 (GRCm39) missense probably benign 0.00
R0508:Frmpd1 UTSW 4 45,284,938 (GRCm39) missense unknown
R0524:Frmpd1 UTSW 4 45,283,774 (GRCm39) missense probably benign 0.00
R0524:Frmpd1 UTSW 4 45,256,902 (GRCm39) missense probably damaging 1.00
R0625:Frmpd1 UTSW 4 45,284,055 (GRCm39) missense probably benign
R0825:Frmpd1 UTSW 4 45,285,394 (GRCm39) missense possibly damaging 0.93
R0926:Frmpd1 UTSW 4 45,268,497 (GRCm39) missense probably damaging 1.00
R0975:Frmpd1 UTSW 4 45,279,000 (GRCm39) missense probably benign 0.01
R1465:Frmpd1 UTSW 4 45,273,197 (GRCm39) missense probably damaging 1.00
R1465:Frmpd1 UTSW 4 45,273,197 (GRCm39) missense probably damaging 1.00
R1573:Frmpd1 UTSW 4 45,283,932 (GRCm39) missense probably benign 0.01
R1938:Frmpd1 UTSW 4 45,283,711 (GRCm39) missense probably damaging 1.00
R2334:Frmpd1 UTSW 4 45,285,408 (GRCm39) missense probably damaging 0.97
R2413:Frmpd1 UTSW 4 45,278,969 (GRCm39) missense probably benign 0.02
R2760:Frmpd1 UTSW 4 45,244,667 (GRCm39) missense possibly damaging 0.77
R3856:Frmpd1 UTSW 4 45,283,698 (GRCm39) missense probably damaging 1.00
R3876:Frmpd1 UTSW 4 45,284,093 (GRCm39) missense probably benign 0.01
R4080:Frmpd1 UTSW 4 45,284,382 (GRCm39) missense probably benign
R4597:Frmpd1 UTSW 4 45,274,441 (GRCm39) missense probably benign 0.12
R4714:Frmpd1 UTSW 4 45,284,785 (GRCm39) missense probably benign 0.11
R4779:Frmpd1 UTSW 4 45,229,865 (GRCm39) missense probably damaging 1.00
R4957:Frmpd1 UTSW 4 45,273,099 (GRCm39) missense probably damaging 1.00
R5000:Frmpd1 UTSW 4 45,261,931 (GRCm39) splice site probably null
R5041:Frmpd1 UTSW 4 45,278,878 (GRCm39) missense probably damaging 1.00
R5228:Frmpd1 UTSW 4 45,284,322 (GRCm39) missense probably damaging 0.98
R5413:Frmpd1 UTSW 4 45,249,196 (GRCm39) missense probably benign 0.00
R5560:Frmpd1 UTSW 4 45,243,697 (GRCm39) missense probably damaging 1.00
R6133:Frmpd1 UTSW 4 45,284,915 (GRCm39) missense probably benign 0.01
R6158:Frmpd1 UTSW 4 45,285,401 (GRCm39) missense probably damaging 1.00
R6329:Frmpd1 UTSW 4 45,268,551 (GRCm39) missense possibly damaging 0.80
R6338:Frmpd1 UTSW 4 45,274,489 (GRCm39) missense probably benign 0.00
R6544:Frmpd1 UTSW 4 45,279,024 (GRCm39) missense probably damaging 1.00
R6728:Frmpd1 UTSW 4 45,284,664 (GRCm39) missense probably benign
R6748:Frmpd1 UTSW 4 45,274,397 (GRCm39) missense probably benign 0.08
R6798:Frmpd1 UTSW 4 45,284,850 (GRCm39) missense probably benign 0.17
R6828:Frmpd1 UTSW 4 45,275,383 (GRCm39) missense probably damaging 0.99
R7002:Frmpd1 UTSW 4 45,284,200 (GRCm39) missense probably benign
R7295:Frmpd1 UTSW 4 45,285,700 (GRCm39) missense probably damaging 1.00
R7382:Frmpd1 UTSW 4 45,278,880 (GRCm39) missense probably benign 0.00
R7423:Frmpd1 UTSW 4 45,256,948 (GRCm39) missense probably damaging 1.00
R7451:Frmpd1 UTSW 4 45,279,558 (GRCm39) missense probably benign 0.11
R7492:Frmpd1 UTSW 4 45,285,237 (GRCm39) missense possibly damaging 0.71
R7524:Frmpd1 UTSW 4 45,271,181 (GRCm39) missense probably benign 0.16
R7610:Frmpd1 UTSW 4 45,279,098 (GRCm39) missense probably damaging 1.00
R7719:Frmpd1 UTSW 4 45,284,841 (GRCm39) missense possibly damaging 0.52
R7724:Frmpd1 UTSW 4 45,229,888 (GRCm39) missense probably damaging 1.00
R7891:Frmpd1 UTSW 4 45,284,478 (GRCm39) missense probably benign 0.06
R8010:Frmpd1 UTSW 4 45,284,272 (GRCm39) missense possibly damaging 0.51
R8260:Frmpd1 UTSW 4 45,244,638 (GRCm39) missense probably damaging 0.99
R8528:Frmpd1 UTSW 4 45,285,034 (GRCm39) missense probably benign
R8794:Frmpd1 UTSW 4 45,279,632 (GRCm39) missense probably benign 0.00
R8798:Frmpd1 UTSW 4 45,285,424 (GRCm39) missense possibly damaging 0.95
R8954:Frmpd1 UTSW 4 45,284,702 (GRCm39) missense probably benign 0.02
R9058:Frmpd1 UTSW 4 45,283,948 (GRCm39) missense probably damaging 1.00
R9178:Frmpd1 UTSW 4 45,285,367 (GRCm39) missense probably damaging 1.00
R9281:Frmpd1 UTSW 4 45,284,127 (GRCm39) missense probably benign 0.11
R9408:Frmpd1 UTSW 4 45,279,182 (GRCm39) missense probably benign 0.00
R9532:Frmpd1 UTSW 4 45,278,886 (GRCm39) missense
Z1088:Frmpd1 UTSW 4 45,284,080 (GRCm39) missense possibly damaging 0.93
Z1177:Frmpd1 UTSW 4 45,275,272 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGAGAGAAGGCTGTGCTGTC -3'
(R):5'- CAGCAACTTGGAGCAGGAAC -3'

Sequencing Primer
(F):5'- AGAAGGCTGTGCTGTCTTGGG -3'
(R):5'- GGGATAATGAGACCCACTGTTCTC -3'
Posted On 2019-06-26