Mutagenetix > Incidental Mutations

Incidental Mutation 'R0581:Atad2'

56442

Institutional Source

Beutler Lab

Gene Symbol

Atad2

Ensembl Gene

ENSMUSG00000022360

Gene Name

ATPase family, AAA domain containing 2

Synonyms

2610509G12Rik

MMRRC Submission

038771-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.357) question?

Stock #

R0581 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58094044-58135082 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58126664 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 139 (T139A)

Ref Sequence

ENSEMBL: ENSMUSP00000043691 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038194]

Predicted Effect

probably benign
Transcript: ENSMUST00000038194
AA Change: T139A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000043691
Gene: ENSMUSG00000022360
AA Change: T139A

Domain	Start	End	E-Value	Type
low complexity region	12	35	N/A	INTRINSIC
low complexity region	36	47	N/A	INTRINSIC
low complexity region	184	199	N/A	INTRINSIC
low complexity region	237	268	N/A	INTRINSIC
low complexity region	337	349	N/A	INTRINSIC
AAA	438	579	9.93e-21	SMART
low complexity region	622	633	N/A	INTRINSIC
SCOP:d1e32a2	751	912	5e-4	SMART
low complexity region	924	947	N/A	INTRINSIC
BROMO	955	1067	1.2e-19	SMART
low complexity region	1213	1235	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226582

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227171

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.3%
20x: 93.7%

Validation Efficiency

95% (42/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large family of ATPases has been described, whose key feature is that they share a conserved region of about 220 amino acids that contains an ATP-binding site. The proteins that belong to this family either contain one or two AAA (ATPases Associated with diverse cellular Activities) domains. AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes. The protein encoded by this gene contains two AAA domains, as well as a bromodomain. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap9	A	G	5: 4,050,620	T2761A	probably benign	Het
Apold1	G	A	6: 134,983,813	V77I	probably benign	Het
Cacna1a	A	T	8: 84,601,936	I1668F	possibly damaging	Het
Ccer2	T	A	7: 28,757,026		probably benign	Het
Cyp2c54	T	A	19: 40,047,555	T304S	probably benign	Het
Dpp4	T	A	2: 62,356,676	M497L	probably benign	Het
Evpl	T	A	11: 116,229,490	I541L	probably benign	Het
Ggn	A	G	7: 29,172,304	T370A	probably benign	Het
Ghr	A	G	15: 3,388,634		probably benign	Het
Gm6605	C	A	7: 38,448,275		noncoding transcript	Het
Gpr68	G	C	12: 100,878,556	P243R	probably damaging	Het
Gtf3c2	G	T	5: 31,159,518	Y720*	probably null	Het
Il2rb	T	A	15: 78,481,936	Y387F	possibly damaging	Het
Kcnu1	T	A	8: 25,937,501	V282E	probably damaging	Het
Krt222	G	A	11: 99,236,192	Q201*	probably null	Het
Lats1	A	G	10: 7,702,941	T610A	possibly damaging	Het
Mroh2a	GT	GTT	1: 88,256,166		probably null	Het
Myh7	T	C	14: 54,985,496	I751V	probably benign	Het
Mypn	A	G	10: 63,162,244	I429T	probably benign	Het
Nemf	A	T	12: 69,322,271	D723E	probably benign	Het
Nlrp4b	T	C	7: 10,714,530	L220P	probably damaging	Het
Npr3	T	A	15: 11,851,450	D418V	probably damaging	Het
Nsd3	A	G	8: 25,710,691	N1270S	probably damaging	Het
Olfr123	A	G	17: 37,796,102	I219M	probably damaging	Het
Olfr344	T	C	2: 36,568,822	S75P	probably damaging	Het
Otogl	G	A	10: 107,789,040	T1579I	possibly damaging	Het
Pkp2	T	A	16: 16,269,783		probably benign	Het
Psd3	T	C	8: 67,720,946	Y301C	probably damaging	Het
Psmb4	T	C	3: 94,886,168	H134R	probably damaging	Het
Ralgapb	A	G	2: 158,492,961	T1043A	probably benign	Het
Sec14l5	T	A	16: 5,178,485		probably null	Het
Serpina12	T	A	12: 104,031,140	Q374L	probably damaging	Het
Serpinb10	C	T	1: 107,546,962	R362*	probably null	Het
Sorcs1	T	A	19: 50,252,701	I416F	possibly damaging	Het
Sparcl1	T	C	5: 104,093,312	D82G	probably damaging	Het
Stat6	A	T	10: 127,648,116	Q89L	probably damaging	Het
Tat	A	G	8: 109,991,638	T52A	possibly damaging	Het
Yipf7	T	A	5: 69,521,063	I128F	probably benign	Het
Zfp112	T	A	7: 24,125,863	C419S	probably damaging	Het
Zzef1	A	G	11: 72,851,900	I769V	probably benign	Het

Other mutations in Atad2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Atad2	APN	15	58116820	missense	probably damaging	1.00
IGL00556:Atad2	APN	15	58100080	missense	probably damaging	1.00
IGL00674:Atad2	APN	15	58108386	missense	possibly damaging	0.49
IGL01407:Atad2	APN	15	58104525	missense	probably benign
IGL02557:Atad2	APN	15	58122597	missense	probably benign	0.04
IGL03060:Atad2	APN	15	58122446	unclassified	probably benign
IGL03308:Atad2	APN	15	58102523	missense	probably benign	0.00
R0113:Atad2	UTSW	15	58120934	unclassified	probably benign
R0195:Atad2	UTSW	15	58099954	splice site	probably benign
R0310:Atad2	UTSW	15	58114257	missense	probably damaging	1.00
R0499:Atad2	UTSW	15	58103240	missense	possibly damaging	0.92
R0499:Atad2	UTSW	15	58120949	missense	probably benign
R0564:Atad2	UTSW	15	58125833	splice site	probably benign
R0578:Atad2	UTSW	15	58105568	missense	probably damaging	1.00
R0667:Atad2	UTSW	15	58098719	missense	probably benign	0.01
R0697:Atad2	UTSW	15	58105543	missense	possibly damaging	0.91
R1219:Atad2	UTSW	15	58134911	missense	probably benign	0.00
R1271:Atad2	UTSW	15	58126589	missense	probably benign	0.00
R1544:Atad2	UTSW	15	58103364	missense	probably damaging	1.00
R1624:Atad2	UTSW	15	58100019	missense	probably damaging	1.00
R1853:Atad2	UTSW	15	58097289	missense	possibly damaging	0.56
R1854:Atad2	UTSW	15	58097289	missense	possibly damaging	0.56
R1855:Atad2	UTSW	15	58097289	missense	possibly damaging	0.56
R1860:Atad2	UTSW	15	58096718	splice site	probably null
R1861:Atad2	UTSW	15	58096718	splice site	probably null
R1876:Atad2	UTSW	15	58106868	missense	probably benign	0.00
R1938:Atad2	UTSW	15	58096705	missense	possibly damaging	0.76
R2158:Atad2	UTSW	15	58098566	missense	possibly damaging	0.95
R3756:Atad2	UTSW	15	58099723	missense	probably benign	0.01
R4256:Atad2	UTSW	15	58116856	missense	probably damaging	1.00
R4762:Atad2	UTSW	15	58108362	missense	probably benign
R4827:Atad2	UTSW	15	58108348	missense	probably benign	0.07
R4838:Atad2	UTSW	15	58103283	missense	probably damaging	1.00
R5238:Atad2	UTSW	15	58108337	missense	possibly damaging	0.90
R5247:Atad2	UTSW	15	58104478	nonsense	probably null
R5685:Atad2	UTSW	15	58116798	missense	possibly damaging	0.95
R5790:Atad2	UTSW	15	58126594	missense	probably damaging	1.00
R5813:Atad2	UTSW	15	58099854	missense	probably benign	0.42
R5886:Atad2	UTSW	15	58098514	nonsense	probably null
R5955:Atad2	UTSW	15	58105659	missense	probably benign	0.06
R6034:Atad2	UTSW	15	58108563	missense	probably damaging	1.00
R6034:Atad2	UTSW	15	58108563	missense	probably damaging	1.00
R6111:Atad2	UTSW	15	58108091	missense	probably benign	0.07
R6209:Atad2	UTSW	15	58118415	missense	probably damaging	1.00
R6587:Atad2	UTSW	15	58121048	missense	probably benign	0.03
R6856:Atad2	UTSW	15	58106813	missense	probably damaging	1.00
R7106:Atad2	UTSW	15	58116766	critical splice donor site	probably null
R7178:Atad2	UTSW	15	58117293	missense	probably damaging	1.00
R7290:Atad2	UTSW	15	58098651	missense	probably benign	0.00
R7421:Atad2	UTSW	15	58134926	missense	probably benign	0.40
R7583:Atad2	UTSW	15	58126664	missense	probably benign
R7861:Atad2	UTSW	15	58125780	missense	probably benign	0.10
R7886:Atad2	UTSW	15	58126136	missense	probably damaging	1.00
R8072:Atad2	UTSW	15	58099978	missense	possibly damaging	0.96
R8126:Atad2	UTSW	15	58105591	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GTAGTGCCCACAGCACAATCCTT -3'
(R):5'- ATTGCAGGCATTCCACAGCACC -3'

Sequencing Primer
(F):5'- TCACCCACAAAATTTGTTCTGG -3'
(R):5'- GATGTTCTGTTGCACATTTTCAAG -3'

Posted On

2013-07-11