Incidental Mutation 'R7258:Zfp653'
ID564426
Institutional Source Beutler Lab
Gene Symbol Zfp653
Ensembl Gene ENSMUSG00000038895
Gene Namezinc finger protein 653
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R7258 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location22055411-22071376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22065820 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 145 (D145G)
Ref Sequence ENSEMBL: ENSMUSP00000137064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043922] [ENSMUST00000179605]
Predicted Effect probably benign
Transcript: ENSMUST00000043922
AA Change: D145G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000045895
Gene: ENSMUSG00000038895
AA Change: D145G

DomainStartEndE-ValueType
AT_hook 29 41 2.28e0 SMART
low complexity region 105 116 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 209 232 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
ZnF_C2H2 467 492 4.11e-2 SMART
ZnF_C2H2 498 522 4.47e-3 SMART
ZnF_C2H2 528 550 4.87e-4 SMART
ZnF_C2H2 556 578 2.99e-4 SMART
ZnF_C2H2 586 609 1.31e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179605
AA Change: D145G

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000137064
Gene: ENSMUSG00000038895
AA Change: D145G

DomainStartEndE-ValueType
AT_hook 29 41 2.28e0 SMART
low complexity region 105 116 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 209 232 N/A INTRINSIC
low complexity region 451 464 N/A INTRINSIC
ZnF_C2H2 475 500 4.11e-2 SMART
ZnF_C2H2 506 530 4.47e-3 SMART
ZnF_C2H2 536 558 4.87e-4 SMART
ZnF_C2H2 564 586 2.99e-4 SMART
ZnF_C2H2 594 617 1.31e0 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik A C 1: 87,475,067 I40L probably benign Het
4933402J07Rik A C 8: 87,586,177 S197R probably damaging Het
Abcc12 T C 8: 86,560,857 R120G possibly damaging Het
Abhd14b A G 9: 106,450,219 I67V probably benign Het
Alpk1 A T 3: 127,724,466 V62E probably damaging Het
Ankar A G 1: 72,651,727 V1196A probably benign Het
B230118H07Rik T C 2: 101,610,592 D22G probably null Het
Ccr5 A T 9: 124,125,274 K305* probably null Het
Cdc42bpb T C 12: 111,326,084 H339R probably damaging Het
Cep290 T G 10: 100,499,108 M330R probably benign Het
Cyfip2 T C 11: 46,224,177 Y901C probably benign Het
Ddx54 T G 5: 120,620,747 Y352D probably damaging Het
Defa35 A T 8: 21,065,229 H55L possibly damaging Het
Dnmt3b T A 2: 153,683,599 probably null Het
Enpep A C 3: 129,332,075 L136R probably benign Het
Epb41l2 G A 10: 25,484,287 A516T probably damaging Het
Frmd4a A T 2: 4,300,953 Q13L probably benign Het
Frmpd1 C A 4: 45,269,974 D271E possibly damaging Het
Gbp5 T A 3: 142,506,781 L410H probably damaging Het
Gipc2 T C 3: 152,165,715 E58G probably damaging Het
Gm281 A T 14: 13,899,648 F91L Het
Gm6309 A T 5: 146,168,296 V269E probably benign Het
Grm5 A T 7: 88,074,706 T735S probably damaging Het
H6pd T C 4: 149,996,362 M9V probably benign Het
Hmcn1 A G 1: 150,715,823 I1875T probably benign Het
Hrc T A 7: 45,336,296 D290E possibly damaging Het
Ippk C A 13: 49,433,862 Q136K probably benign Het
Kcnv1 T C 15: 45,109,315 T391A probably damaging Het
Kdm5b A C 1: 134,621,021 E1088A probably damaging Het
L1td1 C T 4: 98,736,864 A432V probably benign Het
Ly86 A G 13: 37,345,497 D20G probably benign Het
Myo1g A G 11: 6,509,416 I818T possibly damaging Het
Nms A G 1: 38,946,970 T121A probably benign Het
Olfr1084 T A 2: 86,639,001 K236* probably null Het
Olfr1414 A T 1: 92,511,176 I284N possibly damaging Het
Olfr350 T A 2: 36,850,340 I98K probably damaging Het
Olfr391-ps T G 11: 73,799,380 I126L probably damaging Het
Olfr609 G C 7: 103,492,589 C96W probably damaging Het
Olfr816 T A 10: 129,912,287 probably benign Het
Pcdhb9 T C 18: 37,402,114 L387P probably damaging Het
Pcsk1 G A 13: 75,093,186 R95H probably damaging Het
Pde11a T C 2: 76,139,906 D502G possibly damaging Het
Plekhg2 T C 7: 28,364,778 D446G probably benign Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rasal2 A T 1: 157,157,700 L826M probably damaging Het
Rnf213 A G 11: 119,452,575 I3589V Het
Sin3b T C 8: 72,750,208 C757R probably benign Het
Slc41a1 T A 1: 131,842,042 V300D probably benign Het
Snrpa1 T C 7: 66,070,143 F162L probably damaging Het
Sox30 C A 11: 45,980,552 A78E unknown Het
Ssc4d G T 5: 135,963,087 A401E probably damaging Het
Steap3 A G 1: 120,243,986 F130L possibly damaging Het
Stx5a A G 19: 8,754,907 probably null Het
Tgfbr2 A T 9: 116,129,830 I172N probably damaging Het
Tgm4 A G 9: 123,062,491 D557G probably benign Het
Tmprss11c A G 5: 86,271,413 S96P probably damaging Het
Trpa1 T G 1: 14,903,249 T282P probably damaging Het
Uba5 A T 9: 104,062,933 V5E unknown Het
Ugt2b36 A T 5: 87,080,903 L427H probably damaging Het
Utp14b T A 1: 78,664,974 H196Q probably benign Het
Vmn2r44 T A 7: 8,377,849 L348F probably damaging Het
Vmn2r93 T G 17: 18,305,141 L354V probably benign Het
Wwc2 T A 8: 47,842,999 N1079Y unknown Het
Zfp777 T C 6: 48,025,797 E453G probably damaging Het
Zfp936 T A 7: 43,190,379 H423Q probably damaging Het
Zfyve9 A T 4: 108,656,954 Y496N possibly damaging Het
Other mutations in Zfp653
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02541:Zfp653 APN 9 22055783 missense probably damaging 1.00
PIT4403001:Zfp653 UTSW 9 22065757 missense probably damaging 0.96
R1245:Zfp653 UTSW 9 22056422 missense probably damaging 1.00
R1473:Zfp653 UTSW 9 22058220 missense possibly damaging 0.92
R1564:Zfp653 UTSW 9 22055859 missense probably damaging 1.00
R1574:Zfp653 UTSW 9 22057978 nonsense probably null
R1574:Zfp653 UTSW 9 22057978 nonsense probably null
R2851:Zfp653 UTSW 9 22057566 missense probably benign 0.09
R2852:Zfp653 UTSW 9 22057566 missense probably benign 0.09
R2967:Zfp653 UTSW 9 22065730 missense probably damaging 1.00
R4937:Zfp653 UTSW 9 22055778 missense probably damaging 1.00
R5390:Zfp653 UTSW 9 22057803 critical splice donor site probably null
R6135:Zfp653 UTSW 9 22058262 missense probably damaging 0.97
R6798:Zfp653 UTSW 9 22057372 missense probably damaging 1.00
R7146:Zfp653 UTSW 9 22065899 missense probably damaging 1.00
R7486:Zfp653 UTSW 9 22056528 missense probably damaging 1.00
R7515:Zfp653 UTSW 9 22071131 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAGCTACTGTCCTAAAGCC -3'
(R):5'- TCAAACTGGGAATTGTTGGCC -3'

Sequencing Primer
(F):5'- TACTGTCCTAAAGCCACCAGTG -3'
(R):5'- GGAATTGTTGGCCCCAGG -3'
Posted On2019-06-26